SubtiBank SubtiBank
yybM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yybM

unknown
locus
BSU_40590
pI
8.32
mw
28.97 kDa
protein length
251 aa Sequence Blast
gene length
756 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,173,665 → 4,174,420

    Expression and Regulation

    Operons

    genes
    [gene|5A68286ADFB1B334DC626612C74D03AE4DBAF0A7|yybN]-[gene|BA4CB875FD72C7E7767AFA44A5D8C32448F5E18C|yybM]-[gene|CE98D731B8D9BDBF4EB119346BB59F5E5C48C827|yybL]-[gene|8950AD10BE5B6EDA74C341D272201D1BA9DBAC85|yybK]-[gene|6260516A5ED4A49457997592F29CEC10B7A2CCA7|yybJ]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]-[protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA] [Pubmed|27902860,15743949], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA]: repression, [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]-[protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA] [Pubmed|27902860,15743949], in [regulon|6740108089F13116F200C15F35C2E7561E990FEB|DnaA regulon]
  • regulation

  • repressed by [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]-[SW|DnaA] [Pubmed| 27902860,15743949]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B841 (yybM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1840 NBRP B. subtilis, Japan]
  • BKE40590 (Δ[gene|BA4CB875FD72C7E7767AFA44A5D8C32448F5E18C|yybM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTCACTCAATTCTT, downstream forward: _UP4_ACAATGAAAATTAAAAGACT
  • BKK40590 (Δ[gene|BA4CB875FD72C7E7767AFA44A5D8C32448F5E18C|yybM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTCACTCAATTCTT, downstream forward: _UP4_ACAATGAAAATTAAAAGACT
  • References

  • 15743949,23199363,27902860