SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


phosphate [SW|ABC transporter] (binding protein)
31.53 kDa
protein length
300 aa Sequence Blast
gene length
903 bp Sequence Blast
high-affinity phosphate uptake
phosphate [SW|ABC transporter] (binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of ions]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.3|Phosphate metabolism]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    2,580,715 → 2,581,617

    The protein

    Protein family

  • pstS family (single member, according to UniProt)
  • Modification

  • phosphorylated on ser/ thr/ tyr [Pubmed|16493705]
  • Structure

  • [PDB|4ECF] (from Lactobacillus brevis, 52% identity)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9098050], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]-P, [PubMed|9098050,9593301], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed under conditions of phosphate limitation (5000-fold induced) ([protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]) [,9593301 PubMed]
  • additional information

  • mRNA processing between [gene|BA45631351E3C9C140D15F620D7B7AC143C04932|pstS] and [gene|8BC7CCE9EBD899912ED7C72CA04FE82B21516F77|pstC] to maintain higher concentrations of [protein|BA45631351E3C9C140D15F620D7B7AC143C04932|PstS] relative to other components of the [SW|ABC transporter] [PubMed|15289558]
  • view in new tab

    Biological materials


  • MGNA-C420 (yqgG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE24990 (Δ[gene|BA45631351E3C9C140D15F620D7B7AC143C04932|pstS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTGAATTCCCCCTG, downstream forward: _UP4_TGATCTTAATAAAAAGAGGA
  • BKK24990 (Δ[gene|BA45631351E3C9C140D15F620D7B7AC143C04932|pstS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTGAATTCCCCCTG, downstream forward: _UP4_TGATCTTAATAAAAAGAGGA
  • labs

  • [SW|Marion Hulett], University of Illinois at Chicago, USA [ Homepage]
  • References

  • 9098050,12897025,10913081,10092453,15289558,9098050,9593301,18957862,16493705,25666134