SubtiBank SubtiBank
yitG
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yitG

similar to multidrug resistance protein
locus
BSU_10980
pI
9.74
mw
45.35 kDa
protein length
422 aa Sequence Blast
gene length
1269 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,175,985 → 1,177,253

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|BA1A7ECAE0B5690F6E6A67785BAB18628701E2A2|yitG]-[gene|F1A84EC28BE0E306356A331FD362E3CDAE49A3AB|yitF]
    description
    [Pubmed|16497325]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16497325,15699190], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]) [Pubmed|16497325,15699190]
  • view in new tab

    additional information

  • [protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials

    Mutant

  • MGNA-B181 (yitG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1180 NBRP B. subtilis, Japan]
  • BKE10980 (Δ[gene|BA1A7ECAE0B5690F6E6A67785BAB18628701E2A2|yitG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCAGAGCACACTCCTT, downstream forward: _UP4_GCTGAGGAAAGGTAGCACCC
  • BKK10980 (Δ[gene|BA1A7ECAE0B5690F6E6A67785BAB18628701E2A2|yitG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCAGAGCACACTCCTT, downstream forward: _UP4_GCTGAGGAAAGGTAGCACCC
  • References

  • 16497325,15699190,10960106