SubtiBank SubtiBank
yitG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yitG

similar to multidrug resistance protein
locus
BSU_10980
pI
9.74
mw
45.35 kDa
protein length
422 aa Sequence Blast
gene length
1269 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,175,985 → 1,177,253

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|BA1A7ECAE0B5690F6E6A67785BAB18628701E2A2|yitG]-[gene|F1A84EC28BE0E306356A331FD362E3CDAE49A3AB|yitF]
    description
    [Pubmed|16497325]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16497325,15699190], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]) [Pubmed|16497325,15699190]
  • view in new tab

    additional information

  • [protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials

    Mutant

  • MGNA-B181 (yitG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1180 NBRP B. subtilis, Japan]
  • BKE10980 (Δ[gene|BA1A7ECAE0B5690F6E6A67785BAB18628701E2A2|yitG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCAGAGCACACTCCTT, downstream forward: _UP4_GCTGAGGAAAGGTAGCACCC
  • BKK10980 (Δ[gene|BA1A7ECAE0B5690F6E6A67785BAB18628701E2A2|yitG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCAGAGCACACTCCTT, downstream forward: _UP4_GCTGAGGAAAGGTAGCACCC
  • References

  • 16497325,15699190,10960106