SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


spore lipoprotein
20.84 kDa
protein length
189 aa Sequence Blast
gene length
570 bp Sequence Blast
efficient spore [SW|germination]

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW|Additional germination proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    989,022 → 989,591

    Phenotypes of a mutant

  • reduced rate of spore [SW|germination] in L-alanine [pubmed|28333204]
  • The protein


  • forespore inner membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|9611260], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|9611260,15699190], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed during sporulation ([protein|search|SigF], [protein|search|SigG]) [Pubmed|9611260]
  • view in new tab

    additional information

  • the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
  • Biological materials


  • MGNA-A671 (yhcN::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A924 ( ''yhcN''::''erm''), [Pubmed|12813063], available at [ BGSC]
  • BKE09150 (Δ[gene|BA0E4135244D214B435836F07F608818A31B7E52|yhcN]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGAATTCCTCCTTTAT, downstream forward: _UP4_TAAATGAAAGAAGCCGCACA
  • BKK09150 (Δ[gene|BA0E4135244D214B435836F07F608818A31B7E52|yhcN]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGAATTCCTCCTTTAT, downstream forward: _UP4_TAAATGAAAGAAGCCGCACA
  • References

  • 16497325,9611260,26731423,28333204,30782632