SubtiBank SubtiBank
yqeL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqeL

ribosomal silencing factor
locus
BSU_25620
pI
4.37
mw
13.16 kDa
protein length
118 aa Sequence Blast
gene length
357 bp Sequence Blast
function
translation
product
ribosomal silencing factor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.12|Translation/ other]
  • Gene

    Coordinates
    2,642,841 → 2,643,197

    The protein

    Catalyzed reaction/ biological activity

  • silences translation by binding to the L14 protein of the large ribosomal subunit and, as a consequence, impairs subunit joining [Pubmed|22829778]
  • Protein family

  • Iojap/RsfS family (single member, according to UniProt)
  • Structure

  • [PDB|2O5A] (from B. halodurans, 65% identity)
  • [SW|Interactions]

  • [protein|2BE91EEB70A1961D3BBE0603648E64E86CD0B708|RplN]-[protein|B9D5E9B566D28423232C1A28C966CDEA0E5A6B78|YqeL] [Pubmed|22829778], the interaction serves to silence [SW|translation] [Pubmed|22829778]
  • Additional information

  • the protein is enriched in 45S assembly intermediates that accumulate upon depletion of [protein|54CD247926F7FABE4ACE85EB7021B62500B47260|RbgA] [Pubmed|23700310]
  • Expression and Regulation

    Operons

    genes
    [gene|722FD63050EED803C859FFD61338C02D5BB4CC1C|yqeG]-[gene|959C0ED7B9DA50F0EADCF1565405B878D36DA206|yqeH]-[gene|776D79C45DADA631D4A75B0773CFF471A87D9EEC|aroD]-[gene|7774FC36BAEAD33EDD48CB77DA0B5E7E0EA38CA2|yqeI]-[gene|AA4BB1F5B58371D536A6BBA86F6ECB5E5BFB12A8|nadD]-[gene|247C47AC70A0EA53E625871D9BC463A06E6B05FB|yqeK]-[gene|B9D5E9B566D28423232C1A28C966CDEA0E5A6B78|yqeL]-[gene|7F63251ABC07F6C11C57B62CBB948240B08D0181|yqeM]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C500 (yqeL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2498 NBRP B. subtilis, Japan]
  • BKE25620 (Δ[gene|B9D5E9B566D28423232C1A28C966CDEA0E5A6B78|yqeL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCATTCACAAATTCCTCC, downstream forward: _UP4_GATCTTGACTTTGGAATGAA
  • BKK25620 (Δ[gene|B9D5E9B566D28423232C1A28C966CDEA0E5A6B78|yqeL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCATTCACAAATTCCTCC, downstream forward: _UP4_GATCTTGACTTTGGAATGAA
  • References

  • 22829778,23700310,22383849