SubtiBank SubtiBank
yqeL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqeL

ribosomal silencing factor
locus
BSU25620
pI
4.37
mw
13.16 kDa
protein length
118 aa Sequence Blast
gene length
357 bp Sequence Blast
function
translation
product
ribosomal silencing factor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.12|Translation/ other]
  • Gene

    Coordinates
    2,642,841 → 2,643,197

    The protein

    Catalyzed reaction/ biological activity

  • silences translation by binding to the L14 protein of the large ribosomal subunit and, as a consequence, impairs subunit joining [Pubmed|22829778]
  • Protein family

  • Iojap family (according to Swiss-Prot)
  • Structure

  • [PDB|2O5A] (from B. halodurans, 65% identity)
  • [SW|Interactions]

  • [protein|2BE91EEB70A1961D3BBE0603648E64E86CD0B708|RplN]-[protein|B9D5E9B566D28423232C1A28C966CDEA0E5A6B78|YqeL] [Pubmed|22829778], the interaction serves to silence [SW|translation] [Pubmed|22829778]
  • Additional information

  • the protein is enriched in 45S assembly intermediates that accumulate upon depletion of [protein|54CD247926F7FABE4ACE85EB7021B62500B47260|RbgA] [Pubmed|23700310]
  • Expression and Regulation

    Operons

    genes
    [gene|722FD63050EED803C859FFD61338C02D5BB4CC1C|yqeG]-[gene|959C0ED7B9DA50F0EADCF1565405B878D36DA206|yqeH]-[gene|776D79C45DADA631D4A75B0773CFF471A87D9EEC|aroD]-[gene|7774FC36BAEAD33EDD48CB77DA0B5E7E0EA38CA2|yqeI]-[gene|AA4BB1F5B58371D536A6BBA86F6ECB5E5BFB12A8|nadD]-[gene|247C47AC70A0EA53E625871D9BC463A06E6B05FB|yqeK]-[gene|B9D5E9B566D28423232C1A28C966CDEA0E5A6B78|yqeL]-[gene|7F63251ABC07F6C11C57B62CBB948240B08D0181|yqeM]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C500 (yqeL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2498 NBRP B. subtilis, Japan]
  • BKE25620 (Δ[gene|B9D5E9B566D28423232C1A28C966CDEA0E5A6B78|yqeL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCATTCACAAATTCCTCC, downstream forward: _UP4_GATCTTGACTTTGGAATGAA
  • BKK25620 (Δ[gene|B9D5E9B566D28423232C1A28C966CDEA0E5A6B78|yqeL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCATTCACAAATTCCTCC, downstream forward: _UP4_GATCTTGACTTTGGAATGAA
  • References

  • 22829778,23700310,22383849