SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


12.76 kDa
protein length
119 aa Sequence Blast
gene length
360 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    3,606,762 → 3,607,121

    Phenotypes of a mutant

  • a ''yvlD'' point mutation has been isolated upon selction at low pressure [Pubmed|26296725]
  • Expression and Regulation



    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136,12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulation

  • induced by cell wall stress ([protein|search|SigW]) [Pubmed|9987136,12207695]
  • view in new tab

    Biological materials


  • MGNA-A384 (yvlD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE35100 (Δ[gene|B9911180282A2C3DEDEE74CB556F025AF0F26C4E|yvlD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATGCTGACTGCCCATTTTA, downstream forward: _UP4_TAAAAAAAGCTGCCCGCAAA
  • BKK35100 (Δ[gene|B9911180282A2C3DEDEE74CB556F025AF0F26C4E|yvlD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATGCTGACTGCCCATTTTA, downstream forward: _UP4_TAAAAAAAGCTGCCCGCAAA
  • References

  • 12076816,9987136,12207695,220817675,26296725