SubtiBank SubtiBank
yrzN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yrzN

unknown, putative pseudogene
locus
BSU_26559
pI
0.00
mw
0.00 kDa
protein length
gene length
216 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    2,714,590 → 2,714,805

    Expression and Regulation

    Operons

    genes
    [gene|BBF2D58DFC1E345BB841AFDFEF5E651715B1426B|yrkC]-[gene|B97A503AA247375DCA28009A7D3895F6327BE3F5|yrzN]
    description
    [Pubmed|22383849,12480901]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,12480901], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]) [Pubmed|15699190,12480901]
  • view in new tab

    Biological materials

    Mutant

  • BKE26559 (Δ[gene|B97A503AA247375DCA28009A7D3895F6327BE3F5|yrzN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26559 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTACTTAAAATTAGCAC, downstream forward: _UP4_TAAATAGTATCAATTATTTA
  • BKK26559 (Δ[gene|B97A503AA247375DCA28009A7D3895F6327BE3F5|yrzN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26559 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTACTTAAAATTAGCAC, downstream forward: _UP4_TAAATAGTATCAATTATTTA