SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


unknown, putative pseudogene
0.00 kDa
protein length
gene length
216 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    2,714,590 → 2,714,805

    Expression and Regulation



    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,12480901], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]) [Pubmed|15699190,12480901]
  • view in new tab

    Biological materials


  • BKE26559 (Δ[gene|B97A503AA247375DCA28009A7D3895F6327BE3F5|yrzN]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTACTTAAAATTAGCAC, downstream forward: _UP4_TAAATAGTATCAATTATTTA
  • BKK26559 (Δ[gene|B97A503AA247375DCA28009A7D3895F6327BE3F5|yrzN]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTACTTAAAATTAGCAC, downstream forward: _UP4_TAAATAGTATCAATTATTTA