SubtiBank SubtiBank
yndH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yndH

unknown
locus
BSU_17790
pI
8.76
mw
23.66 kDa
protein length
205 aa Sequence Blast
gene length
618 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,912,339 → 1,912,956

    Expression and Regulation

    Operons

    genes
    [gene|963F684823CC1EEACBE5454F37E9B8829EA1EA23|yndG]-[gene|B949DBB16B0476F4073D77BE9F60D03E302FBBC1|yndH]-[gene|D5FE7BD56C10CD05B90DB3EDA0622D1982B38F68|yndJ]-[gene|12F3F8846739480E5980EE01A761990AE24B26F7|yndK]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B112 (yndH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1111 NBRP B. subtilis, Japan]
  • BKE17790 (Δ[gene|B949DBB16B0476F4073D77BE9F60D03E302FBBC1|yndH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATGTCACTTCTTTCTC, downstream forward: _UP4_TCATGAAACGAAATGGCATA
  • BKK17790 (Δ[gene|B949DBB16B0476F4073D77BE9F60D03E302FBBC1|yndH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATGTCACTTCTTTCTC, downstream forward: _UP4_TCATGAAACGAAATGGCATA