SubtiBank SubtiBank
yerC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yerC

similar to Trp repressor of S. aureus
locus
BSU_06580
pI
4.85
mw
11.89 kDa
protein length
104 aa Sequence Blast
gene length
315 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    716,431 → 716,745

    Phenotypes of a mutant

  • inactivation of ''[gene|B948BD67148DC53B371E6748347982067CE28C36|yerC]'' reduces sporulation efficiency to 10% that of wild type cells [Pubmed|26735940]
  • The protein

    Structure

  • [PDB|3KOR] (Trp repressor of Staphylococcus aureus, 67% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|BE1F7BA77CE8B6A1A2D22F31421C27F2E954816A|yerB]-[gene|B948BD67148DC53B371E6748347982067CE28C36|yerC]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    genes
    [gene|E20A5429BCD8719A403229AFB200225EA14EE2DB|yerA]-[gene|BE1F7BA77CE8B6A1A2D22F31421C27F2E954816A|yerB]-[gene|B948BD67148DC53B371E6748347982067CE28C36|yerC]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A924 (yerC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/924 NBRP B. subtilis, Japan]
  • BKE06580 (Δ[gene|B948BD67148DC53B371E6748347982067CE28C36|yerC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCGTAATTTATCGATTTGCA, downstream forward: _UP4_TAAAAAACCGCCCTGCCGTC
  • BKK06580 (Δ[gene|B948BD67148DC53B371E6748347982067CE28C36|yerC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCGTAATTTATCGATTTGCA, downstream forward: _UP4_TAAAAAACCGCCCTGCCGTC
  • References

  • 26735940