SubtiBank SubtiBank
hemAT
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

hemAT

soluble chemotaxis receptor, heme-containing O2 sensor protein, senses ethanol and other short-chain alcohols
locus
BSU_10380
pI
5.44
mw
48.60 kDa
protein length
432 aa Sequence Blast
gene length
1299 bp Sequence Blast
function
movement towards oxygen
product
haem-based aerotactic transducer
essential
no
synonyms
yhfV

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.1|Signal transduction in motility and chemotaxis] → [category|SW 4.1.1.1.3|Soluble chemoreceptors]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.6|Other proteins required for efficient pellicle biofilm formation]
  • Gene

    Coordinates
    1,112,620 → 1,113,918

    Phenotypes of a mutant

  • not essential for pellicle biofilm formation, but mutant is outcompeted by the wild-type strain when competed during pellicle formation [Pubmed|26122431]
  • NCIB3610 ''hemAT'' mutant has higher fitness than ''[gene|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|hag]'' mutant during pellicle formation [Pubmed|26122431]
  • NCIB3610 ''hemAT''-''[gene|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|hag]'' double mutant has similar fitness to single ''[gene|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|hag]'' mutant during pellicle formation [Pubmed|26122431]
  • The protein

    Catalyzed reaction/ biological activity

  • required for full expression of the ''[gene|597771E2E8EC31ED9B2CC8C0E4D888DEEA80F689|phoD]-[gene|E4395255CD43ACB611E0BA872182DF801662C366|tatAD]-[gene|A58C9B9BB6574662A44AF0C7A94DFFE368B740E2|tatCD]'' operon [Pubmed|23180473]
  • [SW|Domains]

  • [SW|Methyl-accepting transducer domain] (aa 184-420) (according to UniProt)
  • [SW|Cofactors]

  • heme
  • Structure

  • [PDB|1OR4] (in cyano-liganded form), [PDB|1OR6] [Pubmed|12962628]
  • [SW|Localization]

  • forms clusters at the cell poles [Pubmed|21515776]
  • homogeneous cytoplasmic distribution in chain-forming cells during the logarithmic phase [Pubmed|23180473]
  • polar foci in individual cells at later growth stages [Pubmed|23180473]
  • Expression and Regulation

    Operons

    genes
    [gene|B948B9D96CDC43A07B3FF90212E52230A0EF1905|hemAT]
    description
    [Pubmed|15033535]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|15033535], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • additional information

  • in minimal medium, HemAT is present with 19,000 +/- 3,900 molecules per cell [PubMed|21515776]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B282 (yhfV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1281 NBRP B. subtilis, Japan]
  • TB239 (''hemAT''::''neo'' in 168) [Pubmed|26122431]
  • TB241 (''hemAT''::''neo'' in NCIB3610) [Pubmed|26122431]
  • BKE10380 (Δ[gene|B948B9D96CDC43A07B3FF90212E52230A0EF1905|hemAT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATACAATGATCCCCCTTG, downstream forward: _UP4_TAACCATCAAAAACCGGTCT
  • BKK10380 (Δ[gene|B948B9D96CDC43A07B3FF90212E52230A0EF1905|hemAT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATACAATGATCCCCCTTG, downstream forward: _UP4_TAACCATCAAAAACCGGTCT
  • labs

  • [SW|Akos T Kovacs]
  • References

    Reviews

  • 23928310
  • Original publications

  • 26122431,10676961,16819829,11481493,15033535,21515776,23180473,22564695,28725484, 33024039