SubtiBank SubtiBank
gbsB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gbsB

choline dehydrogenase (FAD-dependent), glycine betaine synthesis
locus
BSU_31050
pI
4.91
mw
43.39 kDa
protein length
403 aa Sequence Blast
gene length
1209 bp Sequence Blast
function
osmoprotection
product
choline dehydrogenase (FAD-dependent)
essential
no
ec
1.1.1.1
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.4|Biosynthesis of glycine betaine]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • Gene

    Coordinates
    3,183,867 → 3,185,075

    The protein

    Catalyzed reaction/ biological activity

  • choline + NAD+ --> betaine aldehyde + H+ + NADH (according to UniProt)
  • Protein family

  • iron-containing alcohol dehydrogenase family (with [protein|1E951C2B640966643D5F081159522CD1C51942C8|YugJ] and [protein|D81610C7CA2A92FCB1195591ACB613E7C1288F6B|YugK], according to UniProt)
  • [SW|Cofactors]

  • FAD
  • Structure

  • [PDB|3BFJ] (from Klebsiella pneumoniae, 39% identity) [pubmed|19011020]
  • Expression and Regulation

    Operons

    genes
    [gene|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|gbsA]-[gene|B90D4E798145F2AF3421DDC5AB6CD578E2E17900|gbsB]
    description
    [Pubmed|8752328]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8752328], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|GbsR]: repression, [Pubmed|22408163], in [regulon|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|GbsR regulon]
  • regulation

  • induced by choline ([protein|search|GbsR]) [Pubmed|22408163,8752328]
  • view in new tab

    Biological materials

    Mutant

  • 1A1056 ( ''gbsB''::''kan''), [Pubmed|21296969], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A1056&Search=1A1056 BGSC]
  • BKE31050 (Δ[gene|B90D4E798145F2AF3421DDC5AB6CD578E2E17900|gbsB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAATGTCATCATCAATCTCC, downstream forward: _UP4_TAATCAAAATCCCGCTCCTT
  • BKK31050 (Δ[gene|B90D4E798145F2AF3421DDC5AB6CD578E2E17900|gbsB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAATGTCATCATCAATCTCC, downstream forward: _UP4_TAATCAAAATCCCGCTCCTT
  • labs

  • [SW|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi homepage]
  • References

  • 8752328,21296969,22408163,29159878,19011020