SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


8.36 kDa
protein length
gene length
228 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.4|Lifestyles/ miscellaneous]
  • Gene

    3,138,097 → 3,138,324

    The protein

    Protein family

  • UPF0161 family (single member, according to UniProt)
  • Biological materials


  • MGNA-A294 (ytjA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE30680 (Δ[gene|B8E694FD61BAC3776E6CA1F38214CCD254D2F4B7|ytjA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCTTCAGCAACCTT, downstream forward: _UP4_GTTCCTGAAAAGAAACAAAA
  • BKK30680 (Δ[gene|B8E694FD61BAC3776E6CA1F38214CCD254D2F4B7|ytjA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCTTCAGCAACCTT, downstream forward: _UP4_GTTCCTGAAAAGAAACAAAA
  • References

  • 19306042,19306042