SubtiBank SubtiBank
ytjA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ytjA

hemolysin
locus
BSU_30680
pI
10.27
mw
8.36 kDa
protein length
gene length
228 bp Sequence Blast
function
hemolysis
product
hemolysin
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.4|Lifestyles/ miscellaneous]
  • Gene

    Coordinates
    3,138,097 → 3,138,324

    The protein

    Protein family

  • UPF0161 family (single member, according to UniProt)
  • Biological materials

    Mutant

  • MGNA-A294 (ytjA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/294 NBRP B. subtilis, Japan]
  • BKE30680 (Δ[gene|B8E694FD61BAC3776E6CA1F38214CCD254D2F4B7|ytjA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCTTCAGCAACCTT, downstream forward: _UP4_GTTCCTGAAAAGAAACAAAA
  • BKK30680 (Δ[gene|B8E694FD61BAC3776E6CA1F38214CCD254D2F4B7|ytjA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCTTCAGCAACCTT, downstream forward: _UP4_GTTCCTGAAAAGAAACAAAA
  • References

  • 19306042,19306042