SubtiBank SubtiBank
ytjA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ytjA

hemolysin
locus
BSU_30680
pI
10.27
mw
8.36 kDa
protein length
gene length
228 bp Sequence Blast
function
hemolysis
product
hemolysin
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.4|Lifestyles/ miscellaneous]
  • Gene

    Coordinates
    3,138,097 → 3,138,324

    The protein

    Protein family

  • UPF0161 family (single member, according to UniProt)
  • Biological materials

    Mutant

  • MGNA-A294 (ytjA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/294 NBRP B. subtilis, Japan]
  • BKE30680 (Δ[gene|B8E694FD61BAC3776E6CA1F38214CCD254D2F4B7|ytjA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCTTCAGCAACCTT, downstream forward: _UP4_GTTCCTGAAAAGAAACAAAA
  • BKK30680 (Δ[gene|B8E694FD61BAC3776E6CA1F38214CCD254D2F4B7|ytjA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCTTCAGCAACCTT, downstream forward: _UP4_GTTCCTGAAAAGAAACAAAA
  • References

  • 19306042,19306042