SubtiBank SubtiBank
veg
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

veg

negative effector of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] activity
locus
BSU_00440
pI
4.81
mw
9.41 kDa
protein length
gene length
261 bp Sequence Blast
function
control of [SW|biofilm formation]
product
negative effector of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] activity
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.4|Regulation]
  • Gene

    Coordinates
    52,763 → 53,023

    The protein

    Catalyzed reaction/ biological activity

  • overexpression of [gene|B8BEE21D8E14F4B04B004573597EA26F5E6DAA39|veg] induces expression of the [gene|8C13E1EF5437DD8F9906643DEDCBB18DABE3B9E3|tapA]-[gene|09B082BF39703F0D9A5980E643175DBD59F5B228|sipW]-[gene|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA] operon [Pubmed|23378512]
  • [protein|B8BEE21D8E14F4B04B004573597EA26F5E6DAA39|Veg] may inhibit the [protein|920F91E748EE079FF864011D9052B073567C41E4|SlrR]-[protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] interaction [Pubmed|23378512]
  • Structure

  • [PDB|3FB9] (from Streptococcus pneumoniae, 34% identity)
  • [SW|Localization]

  • cytoplasm [pubmed|12761295]
  • Expression and Regulation

    Operons

    genes
    [gene|B8BEE21D8E14F4B04B004573597EA26F5E6DAA39|veg]
    description
    [Pubmed|12761295]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12761295], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • constitutively expressed [Pubmed|12761295]
  • view in new tab

    Biological materials

    Mutant

  • GP2888 (Δ[gene|B8BEE21D8E14F4B04B004573597EA26F5E6DAA39|veg]::ermC trpC2) available in [SW|Jörg Stülke]'s lab
  • MGNA-B909 (veg::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1908 NBRP B. subtilis, Japan]
  • BKE00440 (Δ[gene|B8BEE21D8E14F4B04B004573597EA26F5E6DAA39|veg]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCATCCACCTCACTAC, downstream forward: _UP4_TAACGGGCAGTGAACCTTTT
  • BKK00440 (Δ[gene|B8BEE21D8E14F4B04B004573597EA26F5E6DAA39|veg]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCATCCACCTCACTAC, downstream forward: _UP4_TAACGGGCAGTGAACCTTTT
  • lacZ fusion

  • GP2898 ([gene|DE4857E8A228F145EFB9B7AD817585258344ED1F|amyE]::(Pveg-lacZ cat) trpC2) available in [SW|Jörg Stülke]'s lab
  • References

  • 12761295,23378512,23701187