SubtiBank SubtiBank
splB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

splB

spore photoproduct lyase, radical SAM enzyme
locus
BSU_13930
pI
8.52
mw
39.79 kDa
protein length
342 aa Sequence Blast
gene length
1029 bp Sequence Blast
function
protection of spore DNA against photodamage
product
spore photoproduct lyase
essential
no
synonyms
spl

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    1,461,770 → 1,462,798

    Phenotypes of a mutant

  • sensitive to blue light-induced DNA damage [pubmed|30054368]
  • The protein

    Catalyzed reaction/ biological activity

  • repairs a special thymine dimer (5-thyminyl-5,6-dihydrothymine), which is commonly called spore photoproduct at the early germination phase
  • (5R)-5,6-dihydro-5-(thymidin-7-yl)thymidine in DNA --> thymidine dimer in DNA (according to UniProt)
  • Protein family

  • [SW|Radical SAM superfamily] (according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • uses the [4Fe-4S] cluster to reduce SAM
  • Structure

  • [PDB|4FHC] (SplB from ''Geobacillus thermodenitrificans'', 72% identity, 90% similarity) [Pubmed|22761404]
  • Expression and Regulation

    Operons

    genes
    [gene|8B3B4B181D949BD9B05AD6FCA5B6C773DBD84018|splA]-[gene|B873AE29ACAA0714D5F2E8648449B3280353C8AA|splB]
    description
    [Pubmed|8021181]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,8021181], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|8B3B4B181D949BD9B05AD6FCA5B6C773DBD84018|SplA]: negative autoregulation, in [regulon|8B3B4B181D949BD9B05AD6FCA5B6C773DBD84018|SplA regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16497325]
  • view in new tab

    Biological materials

    Mutant

  • BP130 (Δ''splB''::''spc''), available in [SW|Fabian Commichau]'s and [SW|Jörg Stülke]'s labs [pubmed|30054368]
  • BKE13930 (Δ[gene|B873AE29ACAA0714D5F2E8648449B3280353C8AA|splB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGCCACATCCTTTTC, downstream forward: _UP4_TTCACTTAAACGGGCTGTTG
  • BKK13930 (Δ[gene|B873AE29ACAA0714D5F2E8648449B3280353C8AA|splB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGCCACATCCTTTTC, downstream forward: _UP4_TTCACTTAAACGGGCTGTTG
  • References

    Reviews

  • 23164663,25477522,22197590,26265564,28027411
  • Structure of the spore photoproduct lesion in DNA

  • 24598744
  • Original publications

  • 15699190,8021181,21671623,22197590,23607538,23799365,22761404,16829676,11470912,22906093,16829680,11902862,9733691,28401144,30054368