SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


putative glutamine transporter
50.14 kDa
protein length
465 aa Sequence Blast
gene length
1398 bp Sequence Blast
uptake of glutamine
putative glutamine transporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Amino acid transporters] → [category|SW|Solute:sodium symporter family]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of glutamine/ glutamate]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,938,925 → 1,940,322

    The protein

    Protein family

  • [SW|Alanine or glycine:cation symporter (AGCS) (TC 2.A.25) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|E371BC4F613C40CB0E8C8CAA97387F3E6735D813|GlnT], [protein|A10EA56A7EDA2DF712B5BB87D94A818E39940B44|YrbD], [protein|A69E7536DFE6353C4CD1B09D1258C88BF0FB8B4D|YflA]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot), membrane [Pubmed|18763711]
  • Expression and Regulation



    regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|12823818], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|641C4BDD9702804642E1753A9C779E80FABB3919|GlnR]: repression, [pubmed|28835263], in [regulon|641C4BDD9702804642E1753A9C779E80FABB3919|GlnR regulon]
  • regulation

  • repressed in the absence of good nitrogen sources (glutamine or ammonium) ([gene|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]) [Pubmed|12823818]
  • repressed in the presence of glutamine ([protein|641C4BDD9702804642E1753A9C779E80FABB3919|GlnR]) [Pubmed|28835263]
  • view in new tab

    Biological materials


  • GP1888 (Δ[gene|B84BE9F5BEFE3A295ED5580D66040CD28609A6A1|alsT]::tet), available in [SW|Jörg Stülke]'s lab
  • BKE18120 (Δ[gene|B84BE9F5BEFE3A295ED5580D66040CD28609A6A1|alsT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTACCTCCCGTTTTC, downstream forward: _UP4_TAATATAAATATAAAACAAA
  • BKK18120 (Δ[gene|B84BE9F5BEFE3A295ED5580D66040CD28609A6A1|alsT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTACCTCCCGTTTTC, downstream forward: _UP4_TAATATAAATATAAAACAAA
  • References

  • 12823818,25755103,18763711,29326168,28835263