SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


aspartate carbamoyltransferase
34.02 kDa
protein length
304 aa Sequence Blast
gene length
915 bp Sequence Blast
pyrimidine biosynthesis
aspartate carbamoyltransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Biosynthesis/ acquisition of pyrimidine nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    1,620,476 → 1,621,390

    The protein

    Catalyzed reaction/ biological activity

  • carbamoyl phosphate + L-aspartate --> H+ + N-carbamoyl-L-aspartate + phosphate (according to UniProt)
  • Protein family

  • ATCase/OTCase family (with [protein|11E7D77EF9439F817C10BF5D9671C5AE66AF06DC|ArgF], according to UniProt)
  • Modification

  • phosphorylation on Ser-303 [Pubmed|17218307]
  • Structure

  • [PDB|3R7D] [Pubmed|21663747]
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1709162], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR]: termination/ antitermination, via [SW|RNA switch], in [regulon|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR regulon]
  • regulation

  • induced in the absence of uridine nucleotides ([protein|search|PyrR]) [Pubmed|8206849]
  • view in new tab

    Biological materials


  • BKE15490 (Δ[gene|B83462A50FDDD20FE9BD4681824E30AAD10F506B|pyrB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTTCCCCTCTCTT, downstream forward: _UP4_AATGTGAAAAGAGGAGAAGC
  • BKK15490 (Δ[gene|B83462A50FDDD20FE9BD4681824E30AAD10F506B|pyrB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTTCCCCTCTCTT, downstream forward: _UP4_AATGTGAAAAGAGGAGAAGC
  • References

  • 7868607,8206849,12896995,3015959,7840626,6427186,1709162,3937019,17218307,17322189,21663747