SubtiBank SubtiBank
pyrB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pyrB

aspartate carbamoyltransferase
locus
BSU15490
pI
5.34
mw
34.02 kDa
protein length
304 aa Sequence Blast
gene length
915 bp Sequence Blast
function
pyrimidine biosynthesis
product
aspartate carbamoyltransferase
essential
no
ec
2.1.3.2
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.4|Biosynthesis/ acquisition of pyrimidine nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    1,620,476 → 1,621,390

    The protein

    Catalyzed reaction/ biological activity

  • Carbamoyl phosphate + L-aspartate = phosphate + N-carbamoyl-L-aspartate (according to Swiss-Prot)
  • Protein family

  • ATCase/OTCase family (according to Swiss-Prot)
  • Modification

  • phosphorylation on Ser-303 [Pubmed|17218307]
  • Structure

  • [PDB|3R7D] [Pubmed|21663747]
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
  • Expression and Regulation

    Operons

    genes
    [gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]-[gene|A5C26E10085868A0A193C450DF58D54C636B7C2D|pyrP]-[gene|B83462A50FDDD20FE9BD4681824E30AAD10F506B|pyrB]-[gene|CA16FD3507DCCADB1E01DF25B42C3405C9205B05|pyrC]-[gene|E7741ED6F15044900BDC5F0584246469D2D4D586|pyrAA]-[gene|D57DC8A53E52BC4A2EA894E3C9FD983592882918|pyrAB]-[gene|C20A05AE4CE8AEE0DA767334935CC64106A7FCCB|pyrK]-[gene|E533BEF28579CD04B24E2C728737269E35224450|pyrD]-[gene|5D0D0D2413377FCA92440334E92B5A27A5963D9E|pyrF]-[gene|0197A037D2AF049B295E1DA60187D4614B2BAC51|pyrE]
    description
    [Pubmed|8206849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1709162], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR]: termination/ antitermination, via [SW|RNA switch], in [regulon|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR regulon]
  • regulation

  • induced in the absence of uridine nucleotides ([protein|search|PyrR]) [Pubmed|8206849]
  • view in new tab

    Biological materials

    Mutant

  • BKE15490 (Δ[gene|B83462A50FDDD20FE9BD4681824E30AAD10F506B|pyrB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTTCCCCTCTCTT, downstream forward: _UP4_AATGTGAAAAGAGGAGAAGC
  • BKK15490 (Δ[gene|B83462A50FDDD20FE9BD4681824E30AAD10F506B|pyrB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTTCCCCTCTCTT, downstream forward: _UP4_AATGTGAAAAGAGGAGAAGC
  • References

  • 7868607,8206849,12896995,3015959,7840626,6427186,1709162,3937019,17218307,17322189,21663747