SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


aspartate carbamoyltransferase
34.02 kDa
protein length
304 aa Sequence Blast
gene length
915 bp Sequence Blast
pyrimidine biosynthesis
aspartate carbamoyltransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Biosynthesis/ acquisition of pyrimidine nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    1,620,476 → 1,621,390

    The protein

    Catalyzed reaction/ biological activity

  • carbamoyl phosphate + L-aspartate --> H+ + N-carbamoyl-L-aspartate + phosphate (according to UniProt)
  • Protein family

  • ATCase/OTCase family (with [protein|11E7D77EF9439F817C10BF5D9671C5AE66AF06DC|ArgF], according to UniProt)
  • Modification

  • phosphorylation on Ser-303 [Pubmed|17218307]
  • Structure

  • [PDB|3R7D] [Pubmed|21663747]
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1709162], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR]: termination/ antitermination, via [SW|RNA switch], in [regulon|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR regulon]
  • regulation

  • induced in the absence of uridine nucleotides ([protein|search|PyrR]) [Pubmed|8206849]
  • view in new tab

    Biological materials


  • BKE15490 (Δ[gene|B83462A50FDDD20FE9BD4681824E30AAD10F506B|pyrB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTTCCCCTCTCTT, downstream forward: _UP4_AATGTGAAAAGAGGAGAAGC
  • BKK15490 (Δ[gene|B83462A50FDDD20FE9BD4681824E30AAD10F506B|pyrB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTTCCCCTCTCTT, downstream forward: _UP4_AATGTGAAAAGAGGAGAAGC
  • References

  • 7868607,8206849,12896995,3015959,7840626,6427186,1709162,3937019,17218307,17322189,21663747