SubtiBank SubtiBank
yqjV
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqjV

similar to multidrug resistance protein
locus
BSU_23730
pI
9.91
mw
44.54 kDa
protein length
410 aa Sequence Blast
gene length
1233 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,466,721 → 2,467,953

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|TCR/Tet family] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|B828EEDC29A9F3EDA488347B3D76D600D1EC9CBF|yqjV]-[gene|EAE93C12FF9A0908171F977773671FD7722FC5E7|yqjU]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C402 (yqjV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2400 NBRP B. subtilis, Japan]
  • BKE23730 (Δ[gene|B828EEDC29A9F3EDA488347B3D76D600D1EC9CBF|yqjV]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATTATATTCTCTCCT, downstream forward: _UP4_TAAATAAAAAACGGAAGAGA
  • BKK23730 (Δ[gene|B828EEDC29A9F3EDA488347B3D76D600D1EC9CBF|yqjV]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATTATATTCTCTCCT, downstream forward: _UP4_TAAATAAAAAACGGAAGAGA