SubtiBank SubtiBank
yqhL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqhL

membrane protein
locus
BSU24540
pI
10.37
mw
14.45 kDa
protein length
126 aa Sequence Blast
gene length
381 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,544,995 → 2,545,375

    The protein

    [SW|Domains]

  • N-terminal transmembrane domain (aa 3 ... 23) (according to UniProt)
  • C-terminal rhodanese domain (aa 39 ... 123) (according to UniProt)
  • Structure

  • [PDB|3ICR] (from B. anthracis, the rhodanese domain, corresponds to aa 45 ... 119 of YqhL) [pubmed|19725515]
  • [SW|Localization]

  • membrane associated [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|B818CD783EDCA86E2E9E0504C02A1B74E3604AFC|yqhL]
    description
    [Pubmed|29794222]

    regulation

  • the leader mRNA is processed by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C425 (yqhL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2423 NBRP B. subtilis, Japan]
  • BKE24540 (Δ[gene|B818CD783EDCA86E2E9E0504C02A1B74E3604AFC|yqhL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTGATTCTACTCCTTT, downstream forward: _UP4_TAAAGCAAACAGCTGTCTGG
  • BKK24540 (Δ[gene|B818CD783EDCA86E2E9E0504C02A1B74E3604AFC|yqhL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTGATTCTACTCCTTT, downstream forward: _UP4_TAAAGCAAACAGCTGTCTGG
  • References

  • 18763711,29794222,19725515