SubtiBank SubtiBank
yvaD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvaD

similar to multidrug-efflux transporter
locus
BSU_33560
pI
8.43
mw
15.72 kDa
protein length
133 aa Sequence Blast
gene length
402 bp Sequence Blast
function
unknown
product
subunit of unidentified multidrug transporter
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.14|Multidrug exporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,448,295 → 3,448,696

    The protein

    Protein family

  • paired small multidrug resistance protein family ([SW|PSMR family]) [Pubmed|17942072]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|97CE9735931D02E6E780C955C9BE3A67E5C4C59A|yvaF]-[gene|230D790937DAFB82A04B8597699115E1C1EAE98E|yvaE]-[gene|B7FBC30B744D8B1F26AFC5DCB297FAFAB5C60FB7|yvaD]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B605 (yvaD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1604 NBRP B. subtilis, Japan]
  • BKE33560 (Δ[gene|B7FBC30B744D8B1F26AFC5DCB297FAFAB5C60FB7|yvaD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTCATTTGTACTGCCCGCT, downstream forward: _UP4_TGACAGGTGCCGCTTTTATA
  • BKK33560 (Δ[gene|B7FBC30B744D8B1F26AFC5DCB297FAFAB5C60FB7|yvaD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTCATTTGTACTGCCCGCT, downstream forward: _UP4_TGACAGGTGCCGCTTTTATA
  • References

    Reviews

  • 17942072