SubtiBank SubtiBank
blt
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

blt

spermidine-efflux transporter
locus
BSU26590
pI
10.06
mw
43.26 kDa
protein length
400 aa Sequence Blast
gene length
1203 bp Sequence Blast
function
spermidine export
product
spermidine-efflux transporter
essential
no
synonyms
acfA,bmr2,bmt

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.11|Other exporters]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.6|Metabolism of polyamines]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,716,973 → 2,718,175

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • TCR/tet family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|ADBC0F194B601F736492E54011E0A68351B5BD39|Bmr]
  • Expression and Regulation

    Operons

    genes
    [gene|B7C4BE1A252C6376B28C4FCC6EA9DCF3BC096405|blt]-[gene|34360353D4488F1081FEF9A3CF8F1866D271657D|bltD]
    description
    [Pubmed|7608059]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10200972], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|507E3E5493A88A0CD4CC0B8BE0EC3FCCA65493C7|BltR]: activation, [Pubmed|7608059], in [regulon|507E3E5493A88A0CD4CC0B8BE0EC3FCCA65493C7|BltR regulon]
  • [protein|A7326377132C670B60695EFE0A652B1E4F623698|Mta]: activation, [Pubmed|10200972], in [regulon|A7326377132C670B60695EFE0A652B1E4F623698|Mta regulon]
  • regulation

  • induced in the presence of polyamines [pubmed|29142164]
  • view in new tab

    Biological materials

    Mutant

  • BKE26590 (Δ[gene|B7C4BE1A252C6376B28C4FCC6EA9DCF3BC096405|blt]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGAATTCCCCTTTTAC, downstream forward: _UP4_TAATTCATTTTCTATAAAGT
  • BKK26590 (Δ[gene|B7C4BE1A252C6376B28C4FCC6EA9DCF3BC096405|blt]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGAATTCCCCTTTTAC, downstream forward: _UP4_TAATTCATTTTCTATAAAGT
  • References

  • 10359661,9083003,7608059,10200972