SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


spermidine-efflux transporter
43.26 kDa
protein length
400 aa Sequence Blast
gene length
1203 bp Sequence Blast
spermidine export
spermidine-efflux transporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Other exporters]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Metabolism of polyamines]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,716,973 → 2,718,175

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|TCR/Tet family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|ADBC0F194B601F736492E54011E0A68351B5BD39|Bmr]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10200972], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|507E3E5493A88A0CD4CC0B8BE0EC3FCCA65493C7|BltR]: activation, [Pubmed|7608059], in [regulon|507E3E5493A88A0CD4CC0B8BE0EC3FCCA65493C7|BltR regulon]
  • [protein|A7326377132C670B60695EFE0A652B1E4F623698|Mta]: activation, [Pubmed|10200972], in [regulon|A7326377132C670B60695EFE0A652B1E4F623698|Mta regulon]
  • regulation

  • induced in the presence of polyamines [pubmed|29142164]
  • view in new tab

    Biological materials


  • BKE26590 (Δ[gene|B7C4BE1A252C6376B28C4FCC6EA9DCF3BC096405|blt]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGAATTCCCCTTTTAC, downstream forward: _UP4_TAATTCATTTTCTATAAAGT
  • BKK26590 (Δ[gene|B7C4BE1A252C6376B28C4FCC6EA9DCF3BC096405|blt]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGAATTCCCCTTTTAC, downstream forward: _UP4_TAATTCATTTTCTATAAAGT
  • References

  • 10359661,9083003,7608059,10200972