SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


trigger enzyme, hypoxanthine phosphoribosyltransferase and part of a transcription activator
20.10 kDa
protein length
180 aa Sequence Blast
gene length
543 bp Sequence Blast
purine salvage and interconversion, control of ftsH expression
hypoxanthine phosphoribosyltransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Purine salvage and interconversion]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of transcription factor (other than two-component system)]
  • [category|SW 3|Information processing] → [category|SW 3.5|Targets of second messengers] → [category|SW 3.5.3|Targets of (p)ppGpp]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    76,344 → 76,886

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • IMP diphosphate = hypoxanthine 5-phospho-alpha-D-ribose 1-diphosphate (according to Swiss-Prot)
  • Protein family

  • [SW|Purine/pyrimidine phosphoribosyltransferase family] (according to UniProt)
  • Effectors of protein activity

  • inhibition of enzymatic activity by (p)ppGpp during the ´stringent response´[Pubmed|22981860]
  • Structure

  • [PDB|1J7J] (from ''Salmonella typhimurium'', 51% identity, 73% similarity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7608085], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|473F93EA5ADB78CD23C9C054B5D6B739078DDEEB|TilS]: activation, with [protein|B7BFC170EEC88DEC6CF932F80805D3F2C0BD3738|HprT] [Pubmed|24001521], in [regulon|473F93EA5ADB78CD23C9C054B5D6B739078DDEEB|TilS regulon]
  • [protein|B7BFC170EEC88DEC6CF932F80805D3F2C0BD3738|HprT]: activation, with [protein|473F93EA5ADB78CD23C9C054B5D6B739078DDEEB|TilS] [Pubmed|24001521], in [regulon|B7BFC170EEC88DEC6CF932F80805D3F2C0BD3738|HprT regulon]
  • regulation

  • induced by heat shock (class III)
  • additional information

  • the mRNA is very stable (half-life > 15 min) [ PubMed]
  • view in new tab


    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]) [Pubmed|16497325]
  • view in new tab

    Biological materials


  • BKE00680 (Δ[gene|B7BFC170EEC88DEC6CF932F80805D3F2C0BD3738|hprT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATGATTTTGCTTGCCC, downstream forward: _UP4_TGATCGGCAGCCTGCTTCCG
  • BKK00680 (Δ[gene|B7BFC170EEC88DEC6CF932F80805D3F2C0BD3738|hprT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATGATTTTGCTTGCCC, downstream forward: _UP4_TGATCGGCAGCCTGCTTCCG
  • References


  • 28031352
  • Original publications

  • 18179421,22981860,24001521,6408059,28189581