SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


SAM-dependent class I methyltransferase
21.14 kDa
protein length
194 aa Sequence Blast
gene length
585 bp Sequence Blast
SAM-dependent class I methyltransferase

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    3,120,964 → 3,121,548

    The protein

    Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • [SW|Cofactors]

  • SAM [Pubmed|24637210]
  • Structure

  • [PDB|4PON], apoenzyme [Pubmed|24637210]
  • [PDB|4POO], complex with SAM [Pubmed|24637210]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A165 (ytqB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE30490 (Δ[gene|B7B3DF7FFA4144CBB12A72996C73CFBD7B6DD2D8|ytqB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTAAGGAAGAATTTTCTTCA, downstream forward: _UP4_GTCGCCATCGAAAAAAAAGC
  • BKK30490 (Δ[gene|B7B3DF7FFA4144CBB12A72996C73CFBD7B6DD2D8|ytqB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTAAGGAAGAATTTTCTTCA, downstream forward: _UP4_GTCGCCATCGAAAAAAAAGC
  • References

  • 24637210,24699744