SubtiBank SubtiBank
catD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

catD

essential for viability in the presence of catechol
locus
BSU_08230
pI
10.11
mw
14.28 kDa
protein length
134 aa Sequence Blast
gene length
405 bp Sequence Blast
function
detoxification of catechol
product
unknown
essential
no
synonyms
yfiD

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.7|Detoxification reactions]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    897,588 → 897,992

    Phenotypes of a mutant

  • not viable in the presence of catechol [pubmed|30377275]
  • The protein

    Protein family

  • DoxX family (with [protein|B4384C8C0874BAA7822E9B6DCAB57790018271D8|MhqP], according to UniProt)
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|B7A0D1B3CAA2733A33BCCDDB6774ABF1A0223473|catD]-[gene|AA75013C05E1A88FC51410F9F1B30EE7D15F34C2|catE]
    description
    [Pubmed|16872404]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20639328], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|YodB]: repression, [Pubmed|20639328], in [regulon|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|YodB regulon]
  • [protein|5B9C4932B2E76D6B8F6BDB640D1ADEE28F488FAD|CatR]: repression, [Pubmed|20639328], in [regulon|5B9C4932B2E76D6B8F6BDB640D1ADEE28F488FAD|CatR regulon]
  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|30377275], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • strong induction by diamide and quinones (such as catechol) ([protein|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|YodB], [protein|5B9C4932B2E76D6B8F6BDB640D1ADEE28F488FAD|CatR]) [Pubmed|16872404,20639328]
  • induced by iron starvation ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [pubmed|30377275]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C294 (yfiD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2292 NBRP B. subtilis, Japan]
  • BKE08230 (Δ[gene|B7A0D1B3CAA2733A33BCCDDB6774ABF1A0223473|catD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTATCCTCCTTGATAA, downstream forward: _UP4_GCATAAGAAAAGAGGCATGC
  • BKK08230 (Δ[gene|B7A0D1B3CAA2733A33BCCDDB6774ABF1A0223473|catD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTATCCTCCTTGATAA, downstream forward: _UP4_GCATAAGAAAAGAGGCATGC
  • References

  • 17407181,16872404,20639328,30377275