SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


cell wall-anchored 3'5' cyclic dinucleotide 3' phosphodiesterase, degrades c-di-AMP
159.47 kDa
protein length
1462 aa Sequence Blast
gene length
4389 bp Sequence Blast
degradation of c-di-AMP
cell wall-anchored 3'5' cyclic dinucleotide 3′ phosphodiesterase, degrades c-di-AMP

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.3|Metabolism of signalling nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    855,114 → 859,502

    Phenotypes of a mutant

  • essential according to Kobayshi ''et al.'' [Pubmed|17114254], but a deletion mutant could be constructed [Pubmed|27681641]
  • The protein

    Catalyzed reaction/ biological activity

  • degrades c-di-AMP two 5′ AMP molecules [Pubmed|27414497]
  • nucleoside 2',3'-cyclic phosphate + H2O --> nucleoside 3'-phosphate + H+ (according to UniProt)
  • ribonucleoside 3'-phosphate + H2O --> ribonucleoside + phosphate (according to UniProt)
  • ribonucleoside 5'-phosphate + H2O --> ribonucleoside + phosphate (according to UniProt)
  • Protein family

  • 5'-nucleotidase family (with [protein|DAFBC470DA0FA437B117716DE899A8D3EC454672|YhcR], according to UniProt)
  • Paralogous protein(s)

  • [protein|DAFBC470DA0FA437B117716DE899A8D3EC454672|YhcR]
  • [SW|Cofactors]

  • Mn2+ [Pubmed|27414497]
  • Structure

  • [PDB|2Z1A] (from Thermus thermophilus, 40% identity)
  • [PDB|3GVE] (fragment, aa 37 - 374)
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862], the transmembrane domain serves as retention signal, attached to the cell wall [Pubmed|21800427,22767609]
  • Expression and Regulation



    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|16291680], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|16291680]
  • view in new tab

    Biological materials


  • GP2026 (Δ''yfkN::aphA3''), available in [SW|Jörg Stülke]'s lab [Pubmed|27681641]
  • MGNA-C263 (yfkN::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE07840 (Δ[gene|B791B0603042603CB5B5E03CA129B20D02BC02BC|yfkN]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCAGTTCTCCACCTTTCA, downstream forward: _UP4_TAAAAAAGAGCTGCTCGCTA
  • BKK07840 (Δ[gene|B791B0603042603CB5B5E03CA129B20D02BC02BC|yfkN]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCAGTTCTCCACCTTTCA, downstream forward: _UP4_TAAAAAAGAGCTGCTCGCTA
  • References

  • 14688230,16291680,18957862,12850135,17114254,21800427,27414497,27681641