SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


peptidase T (tripeptidase), zinc-dependent
45.35 kDa
protein length
410 aa Sequence Blast
gene length
1233 bp Sequence Blast
peptide degradation
peptidase T (tripeptidase)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW|Utilization of peptides]
  • Gene

    3,995,075 → 3,996,307

    The protein

    Catalyzed reaction/ biological activity

  • Release of the N-terminal residue from a tripeptide (according to UniProt)
  • Protein family

  • peptidase M20B family (single member, according to UniProt)
  • Paralogous protein(s)

  • [protein|4D56C583BBAF47F384ACFACF7A607FD8BFA59960|YqjE]
  • Structure

  • [PDB|3GBO] (from ''Bacillus cereus (71% identity''), to be published)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B733 (pepT::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE38920 (Δ[gene|B77F24856B19A8101EDDB8A95D4E201F44C789DC|pepT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCAATCATCTCCTTT, downstream forward: _UP4_TAACGCCAAAAGCCAGTCCA
  • BKK38920 (Δ[gene|B77F24856B19A8101EDDB8A95D4E201F44C789DC|pepT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCAATCATCTCCTTT, downstream forward: _UP4_TAACGCCAAAAGCCAGTCCA
  • References

  • 8978088,10987140