SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


15.70 kDa
protein length
160 aa Sequence Blast
gene length
483 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    193,075 → 193,557

    The protein


  • [SW|N-acetyltransferase domain] (aa 5-160) (according to UniProt)
  • Biological materials


  • BKE01710 (Δ[gene|B76F97C45CCCA0306D0ED0BF38156C2D6637C9E2|ybbJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCTTGAGTCATGGGGTGGC, downstream forward: _UP4_TAGTCTTAAGTGAAATAAAA
  • BKK01710 (Δ[gene|B76F97C45CCCA0306D0ED0BF38156C2D6637C9E2|ybbJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCTTGAGTCATGGGGTGGC, downstream forward: _UP4_TAGTCTTAAGTGAAATAAAA