SubtiBank SubtiBank
ybbJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ybbJ

unknown
locus
BSU_01710
pI
9.91
mw
15.70 kDa
protein length
160 aa Sequence Blast
gene length
483 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    193,075 → 193,557

    The protein

    [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 5-160) (according to UniProt)
  • Biological materials

    Mutant

  • BKE01710 (Δ[gene|B76F97C45CCCA0306D0ED0BF38156C2D6637C9E2|ybbJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCTTGAGTCATGGGGTGGC, downstream forward: _UP4_TAGTCTTAAGTGAAATAAAA
  • BKK01710 (Δ[gene|B76F97C45CCCA0306D0ED0BF38156C2D6637C9E2|ybbJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCTTGAGTCATGGGGTGGC, downstream forward: _UP4_TAGTCTTAAGTGAAATAAAA