SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


extrusion of arsenite
38.10 kDa
protein length
346 aa Sequence Blast
gene length
1041 bp Sequence Blast
detoxification of arsenate and arsenite
arsenite exporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Metal ion transporter]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.11|Resistance against toxic metals]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    2,655,753 → 2,656,793

    The protein

    Protein family

  • arsenical resistance-3 (ACR3) (TC 2.A.59) family (single member, according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9537360], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|B3D88B9C89154B77D77FB833CA16FD4F4E29FE96|ArsR]: repression, [Pubmed|9537360], in [regulon|B3D88B9C89154B77D77FB833CA16FD4F4E29FE96|ArsR regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|16497325]
  • view in new tab

    Biological materials


  • BKE25790 (Δ[gene|B749D54249A28A471EF796903A34622A16D5B0BB|arsB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACTTTATCCTCACCTT, downstream forward: _UP4_CACTCGATGTAGAGGTGGAA
  • BKK25790 (Δ[gene|B749D54249A28A471EF796903A34622A16D5B0BB|arsB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACTTTATCCTCACCTT, downstream forward: _UP4_CACTCGATGTAGAGGTGGAA
  • References

  • 9537360,16497325,9537360