SubtiBank SubtiBank
arsB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

arsB

extrusion of arsenite
locus
BSU25790
pI
9.77
mw
38.10 kDa
protein length
346 aa Sequence Blast
gene length
1041 bp Sequence Blast
function
detoxification of arsenate and arsenite
product
arsenite exporter
essential
no
synonyms
yqcL

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.5|Metal ion transporter]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.11|Resistance against toxic metals]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,655,753 → 2,656,793

    The protein

    Protein family

  • ACR3 family (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|B3D88B9C89154B77D77FB833CA16FD4F4E29FE96|arsR]-[gene|74B1AF103E6B236609CD184A1A409A9A04857181|yqcK]-[gene|B749D54249A28A471EF796903A34622A16D5B0BB|arsB]-[gene|DB3527FB78D0B7C144D1699D665788184F19AFE0|arsC]
    description
    [Pubmed|9537360]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9537360], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|B3D88B9C89154B77D77FB833CA16FD4F4E29FE96|ArsR]: repression, [Pubmed|9537360], in [regulon|B3D88B9C89154B77D77FB833CA16FD4F4E29FE96|ArsR regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|16497325]
  • view in new tab

    Biological materials

    Mutant

  • BKE25790 (Δ[gene|B749D54249A28A471EF796903A34622A16D5B0BB|arsB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACTTTATCCTCACCTT, downstream forward: _UP4_CACTCGATGTAGAGGTGGAA
  • BKK25790 (Δ[gene|B749D54249A28A471EF796903A34622A16D5B0BB|arsB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACTTTATCCTCACCTT, downstream forward: _UP4_CACTCGATGTAGAGGTGGAA
  • References

  • 9537360,16497325,9537360