SubtiBank SubtiBank
yccK
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yccK

similar to aldo/ ketoreductase
locus
BSU_02770
pI
5.01
mw
34.65 kDa
protein length
310 aa Sequence Blast
gene length
933 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yzaE

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • Gene

    Coordinates
    298,466 → 299,398

    The protein

    Protein family

  • [SW|Aldo/keto reductase family] (according to UniProt)
  • [SW|Aldo/keto reductase 2 subfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|F1AFFACD36C75702B0BB8F0B4241A9688FB6253C|IolS], [protein|4DF9B105ABA64AFD5106EE75FCC9EFAB52BEFC83|YhdN]
  • [protein|35E890DE5096DF603FC16EF5F2CDF329CE104690|YrpG]:
  • Structure

  • [PDB|1PZ0] ([protein|F1AFFACD36C75702B0BB8F0B4241A9688FB6253C|IolS], 53% identity) [Pubmed|15019785]
  • Expression and Regulation

    Operons

    genes
    [gene|B73D729097C00BE6F3C7FF1708738783EE93C6FB|yccK]
    description
    [Pubmed|17322186]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B977 (yccK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1976 NBRP B. subtilis, Japan]
  • BKE02770 (Δ[gene|B73D729097C00BE6F3C7FF1708738783EE93C6FB|yccK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTCCTTCTCCTTTGA, downstream forward: _UP4_TAAAAAAGGAAATAGCCGTC
  • BKK02770 (Δ[gene|B73D729097C00BE6F3C7FF1708738783EE93C6FB|yccK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTCCTTCTCCTTTGA, downstream forward: _UP4_TAAAAAAGGAAATAGCCGTC
  • References

  • 17322186