rnjB [2018-02-10T00:42:21.000Z]

RNase J2

locus: BSU16780

pI: 9.18

mw: 56.67 kDa

protein length: 515 aa

gene length: 1545 bp

function: RNA processing and degradation

product: RNase J2

essential: no

synonyms: ymfA

Genomic Context

categories

• [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.4|RNases] → [category|SW 3.2.4.2|Endoribonucleases]

Gene

Coordinates: 1,749,418 → 1,751,085

Phenotype of a mutant

• growth advantage at low pressure and at 27°C at normal pressure (has been selected at low pressure) [Pubmed|26296725]

The protein

Catalyzed reaction/ biological activity

• endoribonuclease, involved in processing of ''[gene|3E1131CFA3EDEB3865638F09BE2F6B6ED2570BE2|thrS]'' mRNA

Protein family

• [SW|RNase] J subfamily (according to Swiss-Prot)

Paralogous protein(s)

• [protein|3EB289D0F58A58C693AB588798EE66A731341999|RnjA]

Structure

• [PDB|3ZQ4], RNase J1, 49% identity, 81% similarity [Pubmed|21893285]

[SW|Localization]

• cytoplasm, colocalizes with the ribosomes [Pubmed|27708634]

Expression and Regulation

Operons

• genes: [gene|B73CE26E7AEFACFA82C67F3E7DBBB3F766F739CA|rnjB]
  description: [Pubmed|24187087]

  sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|24187087], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]

  regulation

  • constitutive expression [Pubmed|24187087]

Biological materials

Mutant

• MGNA-B114 (ymfA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1113 NBRP B. subtilis, Japan]
• GP1113 ([gene|B73CE26E7AEFACFA82C67F3E7DBBB3F766F739CA|rnjB]::miniTn10 spc), available in [SW|Jörg Stülke]'s lab
• GP1291 (Δ[gene|B73CE26E7AEFACFA82C67F3E7DBBB3F766F739CA|rnjB]::cat), available in [SW|Jörg Stülke]'s lab
• BKE16780 (Δ[gene|B73CE26E7AEFACFA82C67F3E7DBBB3F766F739CA|rnjB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAATCTATATCCTCCTAG, downstream forward: _UP4_TAATGACTGACTAAAGACCG
• BKK16780 (Δ[gene|B73CE26E7AEFACFA82C67F3E7DBBB3F766F739CA|rnjB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAATCTATATCCTCCTAG, downstream forward: _UP4_TAATGACTGACTAAAGACCG

Expression vectors

• GP1687, chromosomal expression of '' rnjB''-Strep::''kan'' in '' B. subtilis'', available in [SW|Jörg Stülke]'s lab
• GP1724, chromosomal expression of '' rnjB''-Strep::''spc '' in '' B. subtilis'', based on [SW|pGP1389], available in [SW|Jörg Stülke]'s lab
• pGP1438: IPTG inducible expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844], available in [SW|Jörg Stülke]'s lab
• pGP1440: IPTG inducible expression, purification in ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172], available in [SW|Jörg Stülke]'s lab

lacZ fusion

• pGP419 (in [protein|search|pAC7]), available in [SW|Jörg Stülke]'s lab

GFP fusion

• GP1695 (in pHJS-105 [Pubmed|26110430]), expression of '' rnjB-sfGFP''::''spc'' under a xylose-inducible promoter in '' B. subtilis'', available in [SW|Jörg Stülke]'s lab [Pubmed|27708634]
• GP1699 (in [SW|pBP43]), expression of '' rnjB-GFP''::''spc'' under the native promoter, available in [SW|Jörg Stülke]'s lab [Pubmed|27708634]

two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab, [pubmed|19193632]

FLAG-tag construct

• GP1001 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab

Labs working on this gene/protein

• [SW|Harald Putzer], IBPC Paris, France [http://www.ibpc.fr/UPR9073/putzer/recherches_harald.htm Homepage]

References

Reviews

• 20458164,21893280,23403287,21957024,22568516,29314657

Original publications

• 15831787,18204464,18713320,19193632,19633085,20025672,21862575,21893285,24187087,26296725,27708634,28384222,28795788