SubtiBank SubtiBank
rnjB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rnjB

RNase J2
locus
BSU_16780
pI
9.18
mw
56.67 kDa
protein length
555 aa Sequence Blast
gene length
1668 bp Sequence Blast
function
RNA processing and degradation
product
RNase J2
essential
no
synonyms
ymfA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.4|RNases] → [category|SW 3.2.4.2|Endoribonucleases]
  • Gene

    Coordinates
    1,749,418 → 1,751,085

    Phenotypes of a mutant

  • growth advantage at low pressure and at 27°C at normal pressure (has been selected at low pressure) [Pubmed|26296725]
  • The protein

    Catalyzed reaction/ biological activity

  • endoribonuclease, involved in processing of ''[gene|3E1131CFA3EDEB3865638F09BE2F6B6ED2570BE2|thrS]'' mRNA
  • Protein family

  • [SW|metallo-beta-lactamase superfamily] (according to UniProt)
  • [SW|RNase] J subfamily (according to UniProt)
  • Paralogous protein(s)

  • [protein|3EB289D0F58A58C693AB588798EE66A731341999|RnjA]
  • Structure

  • [PDB|3ZQ4], RNase J1, 49% identity, 81% similarity [Pubmed|21893285]
  • [SW|Localization]

  • cytoplasm, colocalizes with the ribosomes [Pubmed|27708634]
  • Expression and Regulation

    Operons

    genes
    [gene|B73CE26E7AEFACFA82C67F3E7DBBB3F766F739CA|rnjB]
    description
    [Pubmed|24187087]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|24187087], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • constitutive expression [Pubmed|24187087]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B114 (ymfA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1113 NBRP B. subtilis, Japan]
  • GP1113 ([gene|B73CE26E7AEFACFA82C67F3E7DBBB3F766F739CA|rnjB]::miniTn10 spc), available in [SW|Jörg Stülke]'s lab
  • GP1291 (Δ[gene|B73CE26E7AEFACFA82C67F3E7DBBB3F766F739CA|rnjB]::cat), available in [SW|Jörg Stülke]'s lab
  • BKE16780 (Δ[gene|B73CE26E7AEFACFA82C67F3E7DBBB3F766F739CA|rnjB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAATCTATATCCTCCTAG, downstream forward: _UP4_TAATGACTGACTAAAGACCG
  • BKK16780 (Δ[gene|B73CE26E7AEFACFA82C67F3E7DBBB3F766F739CA|rnjB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAATCTATATCCTCCTAG, downstream forward: _UP4_TAATGACTGACTAAAGACCG
  • Expression vectors

  • GP1687, chromosomal expression of '' rnjB''-Strep::''kan'' in '' B. subtilis'', available in [SW|Jörg Stülke]'s lab
  • GP1724, chromosomal expression of '' rnjB''-Strep::''spc '' in '' B. subtilis'', based on [SW|pGP1389], available in [SW|Jörg Stülke]'s lab
  • pGP1438: IPTG inducible expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844], available in [SW|Jörg Stülke]'s lab
  • pGP1440: IPTG inducible expression, purification in ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172], available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP419 (in [SW|pAC7]), available in [SW|Jörg Stülke]'s lab
  • GFP fusion

  • GP1695 (in pHJS-105 [Pubmed|26110430]), expression of '' rnjB-sfGFP''::''spc'' under a xylose-inducible promoter in '' B. subtilis'', available in [SW|Jörg Stülke]'s lab [Pubmed|27708634]
  • GP1699 (in [SW|pBP43]), expression of '' rnjB-GFP''::''spc'' under the native promoter, available in [SW|Jörg Stülke]'s lab [Pubmed|27708634]
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab, [pubmed|19193632]
  • FLAG-tag construct

  • GP1001 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Harald Putzer], IBPC Paris, France [http://www.ibpc.fr/UPR9073/putzer/recherches_harald.htm Homepage]
  • References

    Reviews

  • 20458164,21893280,23403287,21957024,22568516,29314657,29651979,31464530
  • Original publications

  • 15831787,18204464,18713320,19193632,19633085,20025672,21862575,21893285,24187087,26296725,27708634,28384222,28795788,29242153