SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


inorganic polyphosphate/ATP-NAD kinase
30.10 kDa
protein length
267 aa Sequence Blast
gene length
804 bp Sequence Blast
generation of NADP from NAD
inorganic polyphosphate/ATP-NAD kinase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of NAD(P)]
  • Gene

    3,021,233 → 3,022,036

    The protein

    Catalyzed reaction/ biological activity

  • ATP + NAD+ --> ADP + H+ + NADP+ (according to UniProt)
  • Protein family

  • NAD kinase family (with [protein|2A2640A0501ECEA44A3C0C4842FAC053FB422A1F|NadF], according to UniProt)
  • Paralogous protein(s)

  • [protein|2A2640A0501ECEA44A3C0C4842FAC053FB422A1F|NadF]
  • Structure

  • [PDB|1YT5] (from ''Thermotoga maritima'') [Pubmed|16511117]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    additional information

  • half-life of the mRNA: 8.4 min, in a [gene|6AC80B5916EEA851E9A7AF586341C58B7E69D8E7|roxS] mutant 15 min, in a [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|rny] mutant 24 min [PubMed|25643072]
  • view in new tab

    Other regulations

  • [protein|6AC80B5916EEA851E9A7AF586341C58B7E69D8E7|RoxS]: translation inhibition, inhibition of translation and initiation of RNA degradation by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|Rny] and [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|Rnc] [Pubmed|25643072] translation is inhibited by binding of the [protein|6AC80B5916EEA851E9A7AF586341C58B7E69D8E7|RoxS] RNA to the mRNA [Pubmed|25643072]
  • Biological materials


  • MGNA-A109 (ytdI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE29540 (Δ[gene|B729EFC0BF0D75765C2D2B0B4F397E0AEE11F1E7|ytdI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCCCATTTCCCCTTTG, downstream forward: _UP4_TAGAAAATAAAAGGACAGGC
  • BKK29540 (Δ[gene|B729EFC0BF0D75765C2D2B0B4F397E0AEE11F1E7|ytdI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCCCATTTCCCCTTTG, downstream forward: _UP4_TAGAAAATAAAAGGACAGGC
  • References

  • 16511117,25643072,21815947