SubtiBank SubtiBank
yhfH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhfH

unknown
locus
BSU_10230
pI
6.73
mw
5.16 kDa
protein length
gene length
141 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,098,120 → 1,098,260

    Expression and Regulation

    Operons

    genes
    [gene|B71A9B38FAAD7F96BB1D733ACB978B12B1EB9EF3|yhfH]
    description
    [Pubmed|21815947]

    regulatory mechanism

  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • additional information

  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    Biological materials

    Mutant

  • BKE10230 (Δ[gene|B71A9B38FAAD7F96BB1D733ACB978B12B1EB9EF3|yhfH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCCCTCTTTCCCCTTTG, downstream forward: _UP4_TAATGAGCGAAAATCCCGCG
  • BKK10230 (Δ[gene|B71A9B38FAAD7F96BB1D733ACB978B12B1EB9EF3|yhfH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCCCTCTTTCCCCTTTG, downstream forward: _UP4_TAATGAGCGAAAATCCCGCG
  • References

  • 21815947,30355672