SubtiBank SubtiBank
liaI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

liaI

resistance against oxidative stress and cell wall antibiotics, membrane anchor for [protein|AE4BF12C368468C553EED7A696D5EFC63F56CA39|LiaH], secondary bacitracin resistance determinant
locus
BSU33130
pI
9.30
mw
13.24 kDa
protein length
126 aa Sequence Blast
gene length
381 bp Sequence Blast
function
resistance against oxidative stress and cell wall antibiotics
product
membrane anchor for [protein|AE4BF12C368468C553EED7A696D5EFC63F56CA39|LiaH]
essential
no
synonyms
yvqI

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,398,550 → 3,398,930

    The protein

    [SW|Localization]

  • cell membrane [Pubmed|24666271]
  • forms highly dynamic membrane-associated foci under non-inducing conditions [Pubmed|24666271]
  • co-localizes with [protein|AE4BF12C368468C553EED7A696D5EFC63F56CA39|LiaH] in distinct static spots at the cytoplasma membrane under stress conditions [Pubmed|24666271]
  • Expression and Regulation

    Operons

    genes
    [gene|B6D1159454969D1D578E05D5CE2259E079688510|liaI]-[gene|AE4BF12C368468C553EED7A696D5EFC63F56CA39|liaH]
    description
    [Pubmed|20639339]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15273097], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR]: activation, [Pubmed|16816187], in [regulon|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR regulon]
  • regulation

  • induced by bacitracin and rhamnolipids, induction requires high bacitracin concentrations ([protein|search|LiaR]) [Pubmed|16816187,22092710,26815905]
  • view in new tab

    genes
    [gene|B6D1159454969D1D578E05D5CE2259E079688510|liaI]-[gene|AE4BF12C368468C553EED7A696D5EFC63F56CA39|liaH]-[gene|A71B0392FFF70EFFC096E7E9BD5FE30792821CDD|liaG]-[gene|C107A958DFA2B0DA4837E2F9F648CD329A3116AC|liaF]-[gene|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|liaS]-[gene|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]
    description
    [Pubmed|14651641]

    regulation

  • ''[protein|search|liaG]'': constitutive
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B040 (yvqI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1039 NBRP B. subtilis, Japan]
  • 1A980 ( ''liaI''::''erm''), [Pubmed|15273097], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A980&Search=1A980 BGSC]
  • BKE33130 (Δ[gene|B6D1159454969D1D578E05D5CE2259E079688510|liaI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCAGATCCTCCTTTCGT, downstream forward: _UP4_TAATATCAATATATTAGGAG
  • BKK33130 (Δ[gene|B6D1159454969D1D578E05D5CE2259E079688510|liaI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCAGATCCTCCTTTCGT, downstream forward: _UP4_TAATATCAATATATTAGGAG
  • References

    Reviews

  • 27344142
  • Original publications

  • 19164152,15273097,17660417,17600057,20057163,16816187,15101989,17660417,12850135,16816187,20639339,20817675,22092710,24666271,26815905,30848888