SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


resistance against oxidative stress and cell wall antibiotics, membrane anchor for [protein|AE4BF12C368468C553EED7A696D5EFC63F56CA39|LiaH], secondary bacitracin resistance determinant
13.24 kDa
protein length
126 aa Sequence Blast
gene length
381 bp Sequence Blast
resistance against oxidative stress and cell wall antibiotics
membrane anchor for [protein|AE4BF12C368468C553EED7A696D5EFC63F56CA39|LiaH]

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,398,550 → 3,398,930

    The protein


  • cell membrane [Pubmed|24666271]
  • forms highly dynamic membrane-associated foci under non-inducing conditions [Pubmed|24666271]
  • co-localizes with [protein|AE4BF12C368468C553EED7A696D5EFC63F56CA39|LiaH] in distinct static spots at the cytoplasma membrane under stress conditions [Pubmed|24666271]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15273097], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR]: activation, [Pubmed|16816187], in [regulon|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR regulon]
  • regulation

  • induced by bacitracin and rhamnolipids, induction requires high bacitracin concentrations ([protein|search|LiaR]) [Pubmed|16816187,22092710,26815905]
  • view in new tab



  • ''[protein|search|liaG]'': constitutive
  • view in new tab

    Biological materials


  • MGNA-B040 (yvqI::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A980 ( ''liaI''::''erm''), [Pubmed|15273097], available at [ BGSC]
  • BKE33130 (Δ[gene|B6D1159454969D1D578E05D5CE2259E079688510|liaI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCAGATCCTCCTTTCGT, downstream forward: _UP4_TAATATCAATATATTAGGAG
  • BKK33130 (Δ[gene|B6D1159454969D1D578E05D5CE2259E079688510|liaI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCAGATCCTCCTTTCGT, downstream forward: _UP4_TAATATCAATATATTAGGAG
  • References


  • 27344142
  • Original publications

  • 19164152,15273097,17660417,17600057,20057163,16816187,15101989,17660417,12850135,16816187,20639339,20817675,22092710,24666271,26815905,30848888