SubtiBank SubtiBank
hisJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

hisJ

histidinol phosphate phosphatase
locus
BSU29620
pI
5.06
mw
30.33 kDa
protein length
268 aa Sequence Blast
gene length
807 bp Sequence Blast
function
biosynthesis of histidine
product
histidinol phosphate phosphatase
essential
no
ec
3.1.3.15
synonyms
ytvP

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.14|Biosynthesis/ acquisition of histidine]
  • Gene

    Coordinates
    3,031,614 → 3,032,420

    Phenotypes of a mutant

  • auxotroph for histidine
  • The protein

    Catalyzed reaction/ biological activity

  • L-histidinol phosphate + H2O = L-histidinol + phosphate (according to Swiss-Prot)
  • Protein family

  • HisK subfamily (according to Swiss-Prot)
  • Structure

  • [PDB|3DCP] (from Listeria monocytogenes, 35% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|B6C931049CF7353042EB3714976735189ADAF0FD|hisJ]-[gene|B940BDAFDAFF086F503613B90526230A7D383B3D|S1129]-[gene|02AB87E514281E00FA23284BE1B92925A6CFD71E|S1130]-[gene|2BE3320FA86A7DF58A9FFF4403A4A874859DBBB7|S1131]-[gene|6EE8DFD3C5EB5A6DBE13685F335776C266488FF8|S1132]-[gene|65F36DED62B1640FBE59ACBBBCC8B469F57B14AC|ytsP]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A427 (ytvP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/427 NBRP B. subtilis, Japan]
  • BKE29620 (Δ[gene|B6C931049CF7353042EB3714976735189ADAF0FD|hisJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGATGTCACCCCATGAA, downstream forward: _UP4_TATGAGGCGTTTTTGGAACG
  • BKK29620 (Δ[gene|B6C931049CF7353042EB3714976735189ADAF0FD|hisJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGATGTCACCCCATGAA, downstream forward: _UP4_TATGAGGCGTTTTTGGAACG
  • labs

  • [SW|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
  • References

  • 10322033