SubtiBank SubtiBank
tig
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

tig

trigger factor (prolyl isomerase)
locus
BSU28230
pI
4.00
mw
47.00 kDa
protein length
424 aa Sequence Blast
gene length
1275 bp Sequence Blast
function
protein folding
product
trigger factor (prolyl isomerase)
essential
no
ec
5.2.1.8
synonyms
yzzH

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.2|Chaperones/ protein folding]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    Coordinates
    2,886,315 → 2,887,589

    Phenotypes of a mutant

  • delayed spore [SW|germination] [Pubmed|25661487]
  • The protein

    Protein family

  • Tig subfamily (according to Swiss-Prot)
  • Modification

  • phosphorylated on Arg-45, the phosphorylation interferes with [protein|B6BF089BDC615205C9E4032380B1F0D5568D7C00|Tig] binding to ribosomes [Pubmed|31221751]
  • phosphorylated on Arg-90 [Pubmed|22517742]
  • phosphorylated on ser/ thr/ tyr [Pubmed|16493705]
  • Structure

  • [PDB|2VRH] (the ''E. coli'' trigger factor) [Pubmed|18497744]
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|B6BF089BDC615205C9E4032380B1F0D5568D7C00|tig]
    description
    [Pubmed|8969504]

    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • [protein|search|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • view in new tab

    Biological materials

    Mutant

  • BKE28230 (Δ[gene|B6BF089BDC615205C9E4032380B1F0D5568D7C00|tig]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGTTTCCCTCCAAAAA, downstream forward: _UP4_TAATATGGTGCATAATAATA
  • BKK28230 (Δ[gene|B6BF089BDC615205C9E4032380B1F0D5568D7C00|tig]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGTTTCCCTCCAAAAA, downstream forward: _UP4_TAATATGGTGCATAATAATA
  • References

    Reviews

  • 16231086,15763705,15837180,19647435,27890920,28724440
  • Original publications

  • 12226666,12224648,9748346,9063446,18497744,16493705,8969504,20525796,22517742,16271892,16091460,15378759,25661487,31221751