SubtiBank SubtiBank
ybgF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ybgF

similar to histidine permase
locus
BSU02400
pI
9.60
mw
50.78 kDa
protein length
470 aa Sequence Blast
gene length
1413 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.2|Other amino acid transporters]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.14|Biosynthesis/ acquisition of histidine]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.5|Utilization of histidine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    260,123 → 261,535

    The protein

    Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|C7FEA1D9C7C96C39CEE83CE3F13D412DE6AFE10E|YdgF], [protein|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|AapA], [protein|1594BA83CED2DA9F86C1CE2A0DC6E1C9B665EACB|GabP], [protein|219586A3F378DC38EA076FD39B99D41136BDE722|YtnA], [protein|423AEC9D260BE53AD22851D999244B89BEB3E84D|HutM], [protein|8C4A8961B2514A8AD531AFB104B10C0797D02AC2|YvbW], [protein|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|YbxG], [protein|9BFB16C12B31ABD70BBB921BCB9E4201E3BDC92D|RocC], [protein|B46A8BCEC56E6252712E30F8BF8DA6B836FDE2F6|RocE]
  • Structure

  • [PDB|5OQT] (arginine transporter from Geobacillus kaustophilus, 23% identity) [pubmed|29416041]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|B6A920650919D5BBBD75CCA58C30A0D8ECE64DA3|ybgF]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|577723B2BF662A44D55DC84444ED64276D8DED17|ybgG]-[gene|B6A920650919D5BBBD75CCA58C30A0D8ECE64DA3|ybgF]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • GP3040 Δ''[gene|B6A920650919D5BBBD75CCA58C30A0D8ECE64DA3|ybgF]''::''cat'', available in [SW|Jörg Stülke]'s lab
  • MGNA-B940 (ybgF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1939 NBRP B. subtilis, Japan]
  • BKE02400 (Δ[gene|B6A920650919D5BBBD75CCA58C30A0D8ECE64DA3|ybgF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTCCAACTTTCTA, downstream forward: _UP4_TAAAAAGAACCTGCCTCCGG
  • BKK02400 (Δ[gene|B6A920650919D5BBBD75CCA58C30A0D8ECE64DA3|ybgF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTCCAACTTTCTA, downstream forward: _UP4_TAAAAAGAACCTGCCTCCGG
  • References

    Research papers

  • 29416041