SubtiBank SubtiBank
ybgF
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ybgF

uncharacterized amino acid permase
locus
BSU_02400
pI
9.60
mw
50.78 kDa
protein length
470 aa Sequence Blast
gene length
1413 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.4|APC superfamily]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    260,123 → 261,535

    The protein

    Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|C7FEA1D9C7C96C39CEE83CE3F13D412DE6AFE10E|YdgF], [protein|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|AapA], [protein|1594BA83CED2DA9F86C1CE2A0DC6E1C9B665EACB|GabP], [protein|219586A3F378DC38EA076FD39B99D41136BDE722|YtnA], [protein|423AEC9D260BE53AD22851D999244B89BEB3E84D|HutM], [protein|8C4A8961B2514A8AD531AFB104B10C0797D02AC2|YvbW], [protein|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|YbxG], [protein|9BFB16C12B31ABD70BBB921BCB9E4201E3BDC92D|RocC], [protein|B46A8BCEC56E6252712E30F8BF8DA6B836FDE2F6|RocE]
  • Structure

  • [PDB|5OQT] (arginine transporter from Geobacillus kaustophilus, 23% identity) [pubmed|29416041]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|B6A920650919D5BBBD75CCA58C30A0D8ECE64DA3|ybgF]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|577723B2BF662A44D55DC84444ED64276D8DED17|ybgG]-[gene|B6A920650919D5BBBD75CCA58C30A0D8ECE64DA3|ybgF]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • GP3040 Δ[gene|B6A920650919D5BBBD75CCA58C30A0D8ECE64DA3|ybgF]::''cat'', available in [SW|Jörg Stülke]'s lab [pubmed|32743959]
  • MGNA-B940 (ybgF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1939 NBRP B. subtilis, Japan]
  • BKE02400 (Δ[gene|B6A920650919D5BBBD75CCA58C30A0D8ECE64DA3|ybgF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTCCAACTTTCTA, downstream forward: _UP4_TAAAAAGAACCTGCCTCCGG
  • BKK02400 (Δ[gene|B6A920650919D5BBBD75CCA58C30A0D8ECE64DA3|ybgF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTCCAACTTTCTA, downstream forward: _UP4_TAAAAAGAACCTGCCTCCGG
  • References

    Research papers

  • 29416041