SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


propionyl-CoA carboxylase
55.12 kDa
protein length
507 aa Sequence Blast
gene length
1524 bp Sequence Blast
lipid metabolism
propionyl-CoA carboxylase

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    2,486,813 → 2,488,336

    The protein

    Catalyzed reaction/ biological activity

  • ATP + hydrogencarbonate + propanoyl-CoA --> (S)-methylmalonyl-CoA + ADP + H+ + phosphate (according to UniProt)
  • Protein family

  • AccD/PCCB family (with [protein|E4997526CC534E38413030E90F7A135ECF65DF40|AccD] and [protein|2192474E13EAF6D2CF97CB957864FC89ED0118E0|YngE], according to UniProt)
  • Paralogous protein(s)

  • [protein|2192474E13EAF6D2CF97CB957864FC89ED0118E0|YngE]
  • [SW|Domains]

  • CoA carboxyltransferase N-terminal domain (aa 1-254) (according to UniProt)
  • CoA carboxyltransferase C-terminal domain (aa 256-501) (according to UniProt)
  • Structure

  • [PDB|1VRG] (from Thermotoga maritima, 57% identity)
  • Biological materials


  • MGNA-C387 (yqjD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE23920 (Δ[gene|B6A05AD90A4AA553A8CCD8FFF504F5AD204ABAFB|yqjD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCGTGTAAAAATGATCCA, downstream forward: _UP4_CTTTAATATGGAGGGACTTA
  • BKK23920 (Δ[gene|B6A05AD90A4AA553A8CCD8FFF504F5AD204ABAFB|yqjD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCGTGTAAAAATGATCCA, downstream forward: _UP4_CTTTAATATGGAGGGACTTA