SubtiBank SubtiBank
glgC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

glgC

glucose-1-phosphate adenylyltransferase
locus
BSU30970
pI
4.86
mw
42.44 kDa
protein length
380 aa Sequence Blast
gene length
1143 bp Sequence Blast
function
glycogen biosynthesis
product
glucose-1-phosphate adenylyltransferase
essential
no
ec
2.7.7.27
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.5|Biosynthesis of glycogen]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    3,168,624 → 3,169,766

    The protein

    Catalyzed reaction/ biological activity

  • ATP + alpha-D-glucose 1-phosphate = diphosphate + ADP-glucose (according to Swiss-Prot)
  • Protein family

  • bacterial/plant glucose-1-phosphate adenylyltransferase family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|63A4FD35A2E72C665BFA3F2632F06C7A0C954087|GlgD]
  • Structure

  • [PDB|5L6S] (E. coli ADP-glucose pyrophosphorylase, 41% identity) [pubmed|27545622]
  • Expression and Regulation

    Operons

    genes
    [gene|52C8DE3C78B680C8883D1CD559CBC2D9ABFCC400|glgB]-[gene|B665735B76462724A3C7A1E89D3E613C18F21399|glgC]-[gene|63A4FD35A2E72C665BFA3F2632F06C7A0C954087|glgD]-[gene|EBEA85AD543B79C321CB5F28D1B7E1248640DC1D|glgA]-[gene|3AB4513126EFF54996A54CB7DEB6062C1A06AAC3|glgP]
    description
    [Pubmed|8145641]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|8145641], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|8145641]
  • view in new tab

    Biological materials

    Mutant

  • BKE30970 (Δ[gene|B665735B76462724A3C7A1E89D3E613C18F21399|glgC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAGCATGGCTACACATTGTT, downstream forward: _UP4_TAATTACTGAAGAGGGGGCA
  • BKK30970 (Δ[gene|B665735B76462724A3C7A1E89D3E613C18F21399|glgC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAGCATGGCTACACATTGTT, downstream forward: _UP4_TAATTACTGAAGAGGGGGCA
  • References

  • 8145641,27545622