SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


minor cardiolipin synthetase
45.68 kDa
protein length
398 aa Sequence Blast
gene length
1197 bp Sequence Blast
phospholipid biosynthesis
minor cardiolipin synthetase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW|Biosynthesis of phospholipids]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,816,654 → 3,817,850

    The protein

    Protein family

  • phospholipase D family (with [protein|2079B210322F26EEC3CCF55611622FADDB1D1BC7|ClsA] and [protein|07752EC6940F43DEBD1E9313A2A195E35EDB9F69|YwiE], according to UniProt)
  • Paralogous protein(s)

  • [protein|07752EC6940F43DEBD1E9313A2A195E35EDB9F69|YwiE], [protein|2079B210322F26EEC3CCF55611622FADDB1D1BC7|ClsA]
  • [SW|Domains]

  • 2 PLD phosphodiesterase domains (aa 141-168, aa 311-338) (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    additional information

  • there is an antisense transcript for [gene|B63AAF0D3277FD776944A09D2546F3E48C8716AD|ywjE] ([gene|22198D5928526CC964233355352D085D0A15DEE8|S1445]) [PubMed|22383849]
  • view in new tab

    Biological materials


  • MGNA-A554 (ywjE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE37190 (Δ[gene|B63AAF0D3277FD776944A09D2546F3E48C8716AD|ywjE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCGGCACTCCTTTCCG, downstream forward: _UP4_TATTTCTTATAAAGGAGAGT
  • BKK37190 (Δ[gene|B63AAF0D3277FD776944A09D2546F3E48C8716AD|ywjE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCGGCACTCCTTTCCG, downstream forward: _UP4_TATTTCTTATAAAGGAGAGT
  • References

  • 18820022,14973018,16514141,22383849