SubtiBank SubtiBank
yfmJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfmJ

similar to predicted oxidoreductase, Zn-dependent and NAD(P)-binding
locus
BSU_07450
pI
4.75
mw
36.51 kDa
protein length
339 aa Sequence Blast
gene length
1020 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    817,810 → 818,829

    The protein

    Protein family

  • NADP-dependent oxidoreductase L4BD family (single member, according to UniProt)
  • Structure

  • [PDB|4B7C] (from ''Pseudomonas Aeruginosa'', 48% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|3DFC1A118B346C7939851BF711FFA31E04A698E8|yfmI]-[gene|B61458337D96A0CF8D0778A03A0DB68B566913D8|yfmJ]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|3DFC1A118B346C7939851BF711FFA31E04A698E8|YfmI]' and '[protein|893BB8D1B43F10B46BB7F2DBFE9BE63E9AEEE8EB|YfmG]' [PubMed|20525796]
  • view in new tab

    genes
    [gene|B61458337D96A0CF8D0778A03A0DB68B566913D8|yfmJ]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C241 (yfmJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2239 NBRP B. subtilis, Japan]
  • BKE07450 (Δ[gene|B61458337D96A0CF8D0778A03A0DB68B566913D8|yfmJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCATCCTCCTATCAC, downstream forward: _UP4_TGAATGAAGATGAAAACGGG
  • BKK07450 (Δ[gene|B61458337D96A0CF8D0778A03A0DB68B566913D8|yfmJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCATCCTCCTATCAC, downstream forward: _UP4_TGAATGAAGATGAAAACGGG
  • References

  • 14651647