SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


flavoprotein, tRNA:m(5)U-54 methyltransferase, glucose-inhibited division protein
47.90 kDa
protein length
435 aa Sequence Blast
gene length
1308 bp Sequence Blast
tRNA modification
tRNA:m(5)U-54 methyltransferase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|tRNA modification and maturation]
  • Gene

    1,685,812 → 1,687,119

    The protein

    Catalyzed reaction/ biological activity

  • catalyzes the folate-dependent C(5)-methylation of uridine at position 54 in the TpsiC loop of tRNA
  • (6R)-5,10-methylene-5,6,7,8-tetrahydrofolate + FADH2 + uridine54 in tRNA --> (6S)-5,6,7,8-tetrahydrofolate + 5-methyluridine54 in tRNA + FAD + H+ (according to UniProt)
  • Protein family

  • MnmG family (with [protein|7809B4F5B9172EBB6C91BDE7B673FB08E82763FF|GidA], according to UniProt)
  • [SW|Cofactors]

  • FAD, methylene-THF [Pubmed|24228791]
  • Structure

  • [PDB|3G5S] (TrmFO from ''Thermus thermophilus'', 54% identity, 79% similarity) [Pubmed|19416846]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7783641], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|11331605], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • repressed during growth in the presence of branched chain amino acids ([protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]) [Pubmed|11331605]
  • additional information

  • the intracellular concentration of CodY is about 2.5 myM (according to [PubMed|20408793])
  • view in new tab

    Biological materials


  • MGNA-B147 (gid::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE16130 (Δ[gene|B6062575849EA65BB7B44A9723676885799E2759|trmFO]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTCACATCTCCTAGT, downstream forward: _UP4_TAGGTATTGATTGCAACCTG
  • BKK16130 (Δ[gene|B6062575849EA65BB7B44A9723676885799E2759|trmFO]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTCACATCTCCTAGT, downstream forward: _UP4_TAGGTATTGATTGCAACCTG
  • References

  • 16027442,20412857,21846722,24228791,21561081,23157377,23095745,19416846,24228791,30968076