SubtiBank SubtiBank
rex
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rex

transcriptional repressor of anaerobically expressed genes involved in anaerobic respiration and fermentation
locus
BSU_05970
pI
6.77
mw
23.95 kDa
protein length
215 aa Sequence Blast
gene length
648 bp Sequence Blast
function
regulation of fermentation and anaerobic respiration
product
transcriptional repressor
essential
no
synonyms
ydiH

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.1|Regulators of electron transport]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.5|Overflow metabolism]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    647,091 → 647,738

    Phenotypes of a mutant

  • inactivation of ''[gene|B5EF521437323EF43F08E5EFDB5C798616CA499A|rex]'' reduces sporulation efficiency to 9.2% that of wild type cells [Pubmed|26735940]
  • inactivation of ''[gene|B5EF521437323EF43F08E5EFDB5C798616CA499A|rex]'' confers resistance to high concentrations of Zn(II) [Pubmed|27935957]
  • The protein

    Protein family

  • transcriptional regulatory rex family (single member, according to UniProt)
  • Effectors of protein activity

  • NADH (indication of low oxygen concentration) releases Rex from DNA [Pubmed|18485070], Rex has a very high affinity for NADH
  • Structure

  • [PDB|2VT2], [PDB|2VT3]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000176 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|4A8D74B83E20FA138ED66F0D8FD456B69B740D92|ydiG]-[gene|B5EF521437323EF43F08E5EFDB5C798616CA499A|rex]-[gene|780FDF3DD260287428B397FFE7F44DDF1917381C|tatAY]-[gene|E60FC9C9B273DD6B07B7B95819525DE5F35113CE|tatCY]
    description
    [Pubmed|22383849]

    regulation

  • constitutitvely expressed [Pubmed|22383849]
  • the mRNA is processed between [gene|B5EF521437323EF43F08E5EFDB5C798616CA499A|rex] and [gene|780FDF3DD260287428B397FFE7F44DDF1917381C|tatAY] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C201 (ydiH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2199 NBRP B. subtilis, Japan]
  • LUW292 (erm), GP834 (erm), both available in the [SW|Stülke] lab
  • BKE05970 (Δ[gene|B5EF521437323EF43F08E5EFDB5C798616CA499A|rex]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGGAATTTTTGATTGATCCT, downstream forward: _UP4_TAGAGGGAAAGGAGGAGCCC
  • BKK05970 (Δ[gene|B5EF521437323EF43F08E5EFDB5C798616CA499A|rex]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGGAATTTTTGATTGATCCT, downstream forward: _UP4_TAGAGGGAAAGGAGGAGCCC
  • labs

  • [SW|Claes von Wachenfeldt], Lund University, Sweden [http://aron.ldc.lu.se/kundwebb/cellorg/mibiol/research/wachen/index.htm Homepage]
  • References

    Reviews

  • 23046954
  • Original publications

  • 16207915,18485070,15231791,17015645,20525796,21402078,22383849,25216269,26735940,27935957,29794222