SubtiBank SubtiBank
ptsG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ptsG

glucose permease of the [SW|phosphotransferase systems|phosphotransferase system], EIICBA of the [category|SW 1.2.2|PTS], [category|SW 3.4.3|Trigger enzyme], control of [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT] activity
locus
BSU_13890
pI
5.41
mw
75.34 kDa
protein length
699 aa Sequence Blast
gene length
2100 bp Sequence Blast
function
glucose transport and phosphorylation, control of [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT] activity
product
glucose permease, trigger enzyme
essential
no
ec
2.7.1.69
synonyms
ptsX,crr

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW 1.2.2.2|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.1|Glycolysis]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.4|Control of PRD-type regulators]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW 3.4.3.1|Trigger enzymes of the PTS that control the activity of PRD-containing transcription factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.3|Phosphorylation on a Cys residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    1,457,187 → 1,459,286

    The protein

    Catalyzed reaction/ biological activity

  • transport and phosphorylation of glucose, receives a phosphate from [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr]]] at the IIA domain (His-620), the phosphate group is then transferred to the IIB domain (Cys-461) an finally to the incoming glucose. In the absence of glucose, PtsG phosphorylates and thereby inactivates the transcriptional antiterminator [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT].
  • D-glucose + Nπ-phospho-L-histidyl-[protein] --> D-glucose 6-phosphate + L-histidyl-[protein] (according to UniProt)
  • Protein family

  • [category|SW 1.2.2|PTS] permease, glucose family [Pubmed|10627040]
  • [SW|Domains]

  • 11x transmembrane domain (16–36, 89–109, 139–159, 180–200, 233–253, 283–303, 313–333, 338–358, 365–385, 388–408)
  • [SW|PTS EIIA domain] type-1 (aa 568–672) (according to UniProt)
  • [SW|PTS EIIB domain] type-1 (aa 439–520) (according to UniProt)
  • [SW|PTS EIIC domain] type-1 (aa 1-424) (according to UniProt)
  • Modification

  • transient phosphorylation ([protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr]]]-dependent) on His-620, then internal phosphotransfer from His-620 to Cys-461
  • Structure

  • [PDB|5IWS] (the IIC domain of B. cereus MalT, 32% identity) [pubmed|27161976]
  • [PDB|1AX3] (IIA domain) [pubmed|9593197]
  • [PDB|1GPR] (IIA domain)
  • [SW|Localization]

  • membrane protein [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]-[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]
    description
    [Pubmed|11902727]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11902727], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT]: antitermination, via the [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT]-dependent [SW|RNA switch] [PubMed|9765562], in [regulon|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT regulon]
  • regulation

  • expression activated by glucose (2 fold) ([protein|search|GlcT]) [Pubmed|12850135]
  • view in new tab

    Biological materials

    Mutant

  • GP778 (Δ[gene|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]-[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]-[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]::spc) [Pubmed|22722928], available in [SW|Jörg Stülke]'s lab
  • BKE13890 (Δ[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT
  • BKK13890 (Δ[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT
  • Expression vectors

  • pGP123 (domains BA, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP141 (domains BA, mut: H620D, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP428 (EIIB, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP437(EIIA in [SW|pGP570], with thrombin cleavage site), available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP34 ([SW|pAC5]) [Pubmed|11902727], available in [SW|Jörg Stülke]'s lab
  • pGP66 ([SW|pAC7]) [Pubmed|11902727], available in [SW|Jörg Stülke]'s lab
  • pGP606 (mutant terminator, [SW|pAC6]), available in [SW|Jörg Stülke]'s lab
  • pGP532 ([SW|pAC7]), available in [SW| Jörg Stülke]'s lab
  • series of promoter deletions are available in [SW|pAC5] and [SW|pAC6], available in [SW|Jörg Stülke]'s lab
  • series of RAT mutants are available in [SW|pAC6], available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]
  • References

    Reviews

  • 18086213
  • Original publications

  • 10627040,12850135,18763711,11902727,9765562,9513271,1956301,10543968,17074746,15155854,14527945,1508157,2120236,9593197,8418852,1581296,1316146,1733770,1942043,1911744,1906345,20081037,22846916,1447219,27161976,9593197,30038046