SubtiBank SubtiBank
ptsG
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

ptsG

trigger enzyme: major glucose permease of the PTS, EIICBA(Glc) and control of GlcT activity
locus
BSU13890
pI
5.41
mw
75.34 kDa
protein length
699 aa Sequence Blast
gene length
2097 bp Sequence Blast
function
glucose transport and phosphorylation, control of GlcT activity
product
trigger enzyme: glucose-specific enzyme IICBA component of the PTS
essential
no
ec
2.7.1.69
synonyms
ptsX, crr

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW 1.2.2.2|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.1|Glycolysis]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.4|Control of PRD-type regulators]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW 3.4.3.1|Trigger enzymes of the PTS that control the activity of PRD-containing transcription factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.3|Phosphorylation on a Cys residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    1,457,187 → 1,459,286

    The protein

    Catalyzed reaction/ biological activity

  • transport and phosphorylation of glucose, receives a phosphate from [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr]]] at the IIA domain (His-620), the phosphate group is then transferred to the IIB domain (Cys-461) an finally to the incoming glucose. In the absence of glucose, PtsG phosphorylates and thereby inactivates the transcriptional antiterminator [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT].
  • Protein family

  • [protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|PtsI] permease, glucose permease (Glc) family [Pubmed|10627040], [protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|PtsI] enzyme II
  • [SW|Domains]

  • 11x transmembrane domain (16–36, 89–109, 139–159, 180–200, 233–253, 283–303, 313–333, 338–358, 365–385, 388–408)
  • PTS EIIC domain ( 1-424)
  • PTS EIIB domain (439–520)
  • PTS EIIA domain (568–672)
  • Modification

  • transient phosphorylation ([protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr]]]-dependent) on His-620, then internal phosphotransfer from His-620 to Cys-461
  • Structure

  • [PDB|1AX3] (IIA domain), [PDB|1GPR] (IIA domain), IIA domain [http://www.ncbi.nlm.nih.gov/Structure/mmdb/mmdbsrv.cgi?Dopt=s&uid=56258 NCBI], NMR IIA domain [http://www.ncbi.nlm.nih.gov/Structure/mmdb/mmdbsrv.cgi?Dopt=s&uid=55395 NCBI]
  • [SW|Localization]

  • membrane protein [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]-[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]
    description
    [Pubmed|11902727]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11902727], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT]: antitermination, via the [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT]-dependent [SW|RNA switch] [PubMed|9765562], in [regulon|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT regulon]
  • regulation

  • expression activated by glucose (2 fold) ([protein|search|GlcT]) [Pubmed|12850135]
  • view in new tab

    Biological materials

    Mutant

  • BKE13890 (Δ[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT
  • BKK13890 (Δ[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT
  • Expression vector

  • pGP123 (domains BA, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP141 (domains BA, mut: H620D, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP428 (EIIB, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP437(EIIA in [SW|pGP570], with thrombin cleavage site), available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP34 ([protein|search|pAC5]) [Pubmed|11902727], available in [SW|Jörg Stülke]'s lab
  • pGP66 ([protein|search|pAC7]) [Pubmed|11902727], available in [SW|Jörg Stülke]'s lab
  • pGP606 (mutant terminator, [protein|search|pAC6]), available in [SW|Jörg Stülke]'s lab
  • pGP532 ([protein|search|pAC7]), available in [SW| Jörg Stülke]'s lab
  • series of promoter deletions are available in [protein|search|pAC5] and [protein|search|pAC6], available in [SW|Jörg Stülke]'s lab
  • series of RAT mutants are available in [protein|search|pAC6], available in [SW|Jörg Stülke]'s lab
  • Labs working on this gene/protein

  • [SW|Jörg Stülke], University of Göttingen, Germany
  • [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]
  • References

    Reviews

  • 18086213
  • Original publications

  • 10627040,12850135,18763711,11902727,9765562,9513271,1956301,10543968,17074746,15155854,14527945,1508157,2120236,9593197,8418852,1581296,1316146,1733770,1942043,1911744,1906345,20081037,22846916,1447219