SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


glucose permease of the [SW|phosphotransferase systems|phosphotransferase system], EIICBA of the [category|SW 1.2.2|PTS], [category|SW 3.4.3|Trigger enzyme], control of [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT] activity
75.34 kDa
protein length
699 aa Sequence Blast
gene length
2100 bp Sequence Blast
glucose transport and phosphorylation, control of [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT] activity
glucose permease, trigger enzyme

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|Glycolysis]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of PRD-type regulators]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW|Trigger enzymes of the PTS that control the activity of PRD-containing transcription factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.3|Phosphorylation on a Cys residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    1,457,187 → 1,459,286

    The protein

    Catalyzed reaction/ biological activity

  • transport and phosphorylation of glucose, receives a phosphate from [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr]]] at the IIA domain (His-620), the phosphate group is then transferred to the IIB domain (Cys-461) an finally to the incoming glucose. In the absence of glucose, PtsG phosphorylates and thereby inactivates the transcriptional antiterminator [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT].
  • D-glucose + Nπ-phospho-L-histidyl-[protein] --> D-glucose 6-phosphate + L-histidyl-[protein] (according to UniProt)
  • Protein family

  • [category|SW 1.2.2|PTS] permease, glucose family [Pubmed|10627040]
  • [SW|Domains]

  • 11x transmembrane domain (16–36, 89–109, 139–159, 180–200, 233–253, 283–303, 313–333, 338–358, 365–385, 388–408)
  • [SW|PTS EIIA domain] type-1 (aa 568–672) (according to UniProt)
  • [SW|PTS EIIB domain] type-1 (aa 439–520) (according to UniProt)
  • [SW|PTS EIIC domain] type-1 (aa 1-424) (according to UniProt)
  • Modification

  • transient phosphorylation ([protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr]]]-dependent) on His-620, then internal phosphotransfer from His-620 to Cys-461
  • Structure

  • [PDB|5IWS] (the IIC domain of B. cereus MalT, 32% identity) [pubmed|27161976]
  • [PDB|1AX3] (IIA domain) [pubmed|9593197]
  • [PDB|1GPR] (IIA domain)
  • [SW|Localization]

  • membrane protein [Pubmed|18763711]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11902727], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT]: antitermination, via the [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT]-dependent [SW|RNA switch] [PubMed|9765562], in [regulon|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT regulon]
  • regulation

  • expression activated by glucose (2 fold) ([protein|search|GlcT]) [Pubmed|12850135]
  • view in new tab

    Biological materials


  • GP778 (Δ[gene|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]-[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]-[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]::spc) [Pubmed|22722928], available in [SW|Jörg Stülke]'s lab
  • BKE13890 (Δ[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT
  • BKK13890 (Δ[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT
  • Expression vectors

  • pGP123 (domains BA, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP141 (domains BA, mut: H620D, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP428 (EIIB, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP437(EIIA in [SW|pGP570], with thrombin cleavage site), available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP34 ([SW|pAC5]) [Pubmed|11902727], available in [SW|Jörg Stülke]'s lab
  • pGP66 ([SW|pAC7]) [Pubmed|11902727], available in [SW|Jörg Stülke]'s lab
  • pGP606 (mutant terminator, [SW|pAC6]), available in [SW|Jörg Stülke]'s lab
  • pGP532 ([SW|pAC7]), available in [SW| Jörg Stülke]'s lab
  • series of promoter deletions are available in [SW|pAC5] and [SW|pAC6], available in [SW|Jörg Stülke]'s lab
  • series of RAT mutants are available in [SW|pAC6], available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Jörg Stülke], University of Göttingen, Germany [ Homepage]
  • References


  • 18086213
  • Original publications

  • 10627040,12850135,18763711,11902727,9765562,9513271,1956301,10543968,17074746,15155854,14527945,1508157,2120236,9593197,8418852,1581296,1316146,1733770,1942043,1911744,1906345,20081037,22846916,1447219,27161976,9593197,30038046,31740237