SubtiBank SubtiBank
yokD
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yokD

similar to aminoglycoside N3-acetyltransferase
locus
BSU_21630
pI
6.70
mw
30.76 kDa
protein length
272 aa Sequence Blast
gene length
819 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,281,667 → 2,282,485

    The protein

    Protein family

  • [SW|Acetyltransferase family] (according to UniProt)
  • Structure

  • [PDB|2NYG], [PDB|3IJW] (complex with CoA, from ''B. anthracis'')
  • Expression and Regulation

    Operons

    genes
    [gene|B5DC3ECD047CCB48D3A40E23A4326BBAF088C1AA|yokD]

    description

  • [pubmed|22383849]
  • view in new tab

    Biological materials

    Mutant

  • BKE21630 (Δ[gene|B5DC3ECD047CCB48D3A40E23A4326BBAF088C1AA|yokD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTAGTTCATCTCCTATC, downstream forward: _UP4_TAGCTTGGTCTACCAAATGA
  • BKK21630 (Δ[gene|B5DC3ECD047CCB48D3A40E23A4326BBAF088C1AA|yokD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTAGTTCATCTCCTATC, downstream forward: _UP4_TAGCTTGGTCTACCAAATGA
  • References

  • 21601576