SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


hydroxyethylthiazole phosphate biosynthesis
26.87 kDa
protein length
256 aa Sequence Blast
gene length
771 bp Sequence Blast
biosynthesis of thiamine
thiamin thiazole synthase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis/ acquisition of thiamine]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    1,245,041 → 1,245,811

    The protein

    Catalyzed reaction/ biological activity

  • 1-deoxy-D-xylulose 5-phosphate + 2-iminoacetate + [sulfur-carrier protein ThiS]-C-terminal Gly-NH-CH2-C(O)SH --> 2-[(2R,5Z)-2-carboxy-4-methylthiazol-5(2H)-ylidene]ethyl phosphate + [sulfur-carrier protein ThiS]-C-terminal Gly-Gly + 2 H+ + 2 H2O (according to UniProt)
  • Protein family

  • ThiG family (single member, according to UniProt)
  • Modification

  • phosphorylated on ser/ thr/ tyr [Pubmed|16493705], [Pubmed|17726680]
  • Structure

  • [PDB|1XM3], [PDB|1TYG] (complex with [protein|95DA3F899037140F48B99E065C768356CE08FA94|ThiS]) [Pubmed|15362849]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    regulatory mechanism

  • [protein|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box]: [SW|RNA switch], via [SW|RNA switch], in [regulon|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box regulon]
  • regulation

  • repressed by thiamine ([SW|Thi-box]) [Pubmed|16356850]
  • the [SW|Thi-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials


  • MGNA-B165 (yjbT::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE11690 (Δ[gene|B58B8F260E446E28BC2E3A9AA84EA771EC0A8634|thiG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTCATCCGCCTCCTACAAA, downstream forward: _UP4_GTATGACAGGCAGGTATTCA
  • BKK11690 (Δ[gene|B58B8F260E446E28BC2E3A9AA84EA771EC0A8634|thiG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTCATCCGCCTCCTACAAA, downstream forward: _UP4_GTATGACAGGCAGGTATTCA
  • References


  • 19348578,10382260
  • Original publications

  • 15362849,17726680,16493705,19216519,14567704