SubtiBank SubtiBank
thiG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

thiG

hydroxyethylthiazole phosphate biosynthesis
locus
BSU_11690
pI
4.72
mw
26.87 kDa
protein length
256 aa Sequence Blast
gene length
771 bp Sequence Blast
function
biosynthesis of thiamine
product
thiamin thiazole synthase
essential
no
synonyms
yjbT

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.3|Biosynthesis/ acquisition of thiamine]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    Coordinates
    1,245,041 → 1,245,811

    The protein

    Catalyzed reaction/ biological activity

  • 1-deoxy-D-xylulose 5-phosphate + 2-iminoacetate + [sulfur-carrier protein ThiS]-C-terminal Gly-NH-CH2-C(O)SH --> 2-[(2R,5Z)-2-carboxy-4-methylthiazol-5(2H)-ylidene]ethyl phosphate + [sulfur-carrier protein ThiS]-C-terminal Gly-Gly + 2 H+ + 2 H2O (according to UniProt)
  • Protein family

  • ThiG family (single member, according to UniProt)
  • Modification

  • phosphorylated on ser/ thr/ tyr [Pubmed|16493705], [Pubmed|17726680]
  • Structure

  • [PDB|1XM3], [PDB|1TYG] (complex with [protein|95DA3F899037140F48B99E065C768356CE08FA94|ThiS]) [Pubmed|15362849]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|47E47FB7D9C079DF603906694C4649A049814346|tenA]-[gene|CA6AAE8AC5B5EF01A911B035F8782579CD876C08|tenI]-[gene|87B5C84B7EE10F60B545CCFEF6A527A546B80432|thiO]-[gene|95DA3F899037140F48B99E065C768356CE08FA94|thiS]-[gene|B58B8F260E446E28BC2E3A9AA84EA771EC0A8634|thiG]-[gene|CCD3DDE9E52FCD4906735059CF30593BEB56FD1B|thiF]-[gene|97EDB4ACD64C5FA2E6014ED133DF18F602FF58BB|thiD]
    description
    [Pubmed|1898926]

    regulatory mechanism

  • [protein|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box]: [SW|RNA switch], via [SW|RNA switch], in [regulon|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box regulon]
  • regulation

  • repressed by thiamine ([SW|Thi-box]) [Pubmed|16356850]
  • the [SW|Thi-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B165 (yjbT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1164 NBRP B. subtilis, Japan]
  • BKE11690 (Δ[gene|B58B8F260E446E28BC2E3A9AA84EA771EC0A8634|thiG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTCATCCGCCTCCTACAAA, downstream forward: _UP4_GTATGACAGGCAGGTATTCA
  • BKK11690 (Δ[gene|B58B8F260E446E28BC2E3A9AA84EA771EC0A8634|thiG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTCATCCGCCTCCTACAAA, downstream forward: _UP4_GTATGACAGGCAGGTATTCA
  • References

    Reviews

  • 19348578,10382260
  • Original publications

  • 15362849,17726680,16493705,19216519,14567704