SubtiBank SubtiBank
gerPB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gerPB

spore germination protein, facilitates access of nutrient germinants to their cognate germinant receptors in spores’ inner membrane
locus
BSU_10710
pI
4.80
mw
8.54 kDa
protein length
gene length
243 bp Sequence Blast
function
germination
product
unknown
essential
no
synonyms
yisG

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.2|Additional germination proteins]
  • Gene

    Coordinates
    1,149,958 → 1,150,200

    Expression and Regulation

    Operons

    genes
    [gene|C4DA51243A4249B2489133C8EF0F8A30B05F4C86|gerPA]-[gene|B52A09BF195FE8E143FCB2EF5EBA53454A4ED3D5|gerPB]-[gene|2C49C261D2C7EEDD8E01A384917B63B6965B4AB9|gerPC]-[gene|F8658BB6D52793F8EC289FEC652241D729D72BF6|gerPD]-[gene|53833A2E7176C04AF2E3F7CD7FC9928DC1A0110D|gerPE]-[gene|C2DDBBD801BC61B89024198624360CC55D208247|gerPF]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|15699190,10715007]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|gerPA]' and '[protein|search|yisI]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • BKE10710 (Δ[gene|B52A09BF195FE8E143FCB2EF5EBA53454A4ED3D5|gerPB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAAGTTCATGAGCCTCACTC, downstream forward: _UP4_TAATCATATGAAAGAGGTGA
  • BKK10710 (Δ[gene|B52A09BF195FE8E143FCB2EF5EBA53454A4ED3D5|gerPB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAAGTTCATGAGCCTCACTC, downstream forward: _UP4_TAATCATATGAAAGAGGTGA
  • References

  • 10715007