SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


35.00 kDa
protein length
307 aa Sequence Blast
gene length
924 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    2,058,715 → 2,059,638

    Biological materials


  • MGNA-B407 (yobF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE18890 (Δ[gene|B522299A1691AF15775DBAD82C7A192126423263|yobF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACCTCCGGGTAGATAA, downstream forward: _UP4_TAATTATAGAGATTTCCACT
  • BKK18890 (Δ[gene|B522299A1691AF15775DBAD82C7A192126423263|yobF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACCTCCGGGTAGATAA, downstream forward: _UP4_TAATTATAGAGATTTCCACT