SubtiBank SubtiBank
yxeI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxeI

penicillin acylase
locus
BSU_39540
pI
5.28
mw
37.04 kDa
protein length
328 aa Sequence Blast
gene length
987 bp Sequence Blast
function
resistance to penicillin
product
penicillin acylase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • Gene

    Coordinates
    4,062,543 → 4,063,529

    The protein

    Catalyzed reaction/ biological activity

  • acylation of penicillin V [Pubmed|21978958]
  • Protein family

  • peptidase C59 family (single member, according to UniProt)
  • Structure

  • [PDB|2OQC]
  • Expression and Regulation

    Operons

    genes
    [gene|B5153BCBEFFEA973B99F8B54047EF6FD830CAEE8|yxeI]-[gene|2976D8A6F6F40BA3FF226CF7B67F25DD237373D1|yxeJ]
    description
    [Pubmed|10746760]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B708 (yxeI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1707 NBRP B. subtilis, Japan]
  • BKE39540 (Δ[gene|B5153BCBEFFEA973B99F8B54047EF6FD830CAEE8|yxeI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGATCAGTCCCCTTTT, downstream forward: _UP4_ATTCATGAGCTTAATTAATT
  • BKK39540 (Δ[gene|B5153BCBEFFEA973B99F8B54047EF6FD830CAEE8|yxeI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGATCAGTCCCCTTTT, downstream forward: _UP4_ATTCATGAGCTTAATTAATT
  • References

  • 10746760,15937167,21978958