SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


penicillin acylase
37.04 kDa
protein length
328 aa Sequence Blast
gene length
987 bp Sequence Blast
resistance to penicillin
penicillin acylase

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • Gene

    4,062,543 → 4,063,529

    The protein

    Catalyzed reaction/ biological activity

  • acylation of penicillin V [Pubmed|21978958]
  • Protein family

  • peptidase C59 family (single member, according to UniProt)
  • Structure

  • [PDB|2OQC]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B708 (yxeI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE39540 (Δ[gene|B5153BCBEFFEA973B99F8B54047EF6FD830CAEE8|yxeI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGATCAGTCCCCTTTT, downstream forward: _UP4_ATTCATGAGCTTAATTAATT
  • BKK39540 (Δ[gene|B5153BCBEFFEA973B99F8B54047EF6FD830CAEE8|yxeI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGATCAGTCCCCTTTT, downstream forward: _UP4_ATTCATGAGCTTAATTAATT
  • References

  • 10746760,15937167,21978958