SubtiBank SubtiBank
ndk
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ndk

nucleoside diphosphate kinase
locus
BSU_22730
pI
5.57
mw
16.82 kDa
protein length
149 aa Sequence Blast
gene length
450 bp Sequence Blast
function
maintainance of an equilibrium between the concentrations of different nucleoside triphosphates
product
nucleoside diphosphate kinase
essential
no
ec
2.7.4.6
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.4|Nucleotide metabolism/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • Gene

    Coordinates
    2,381,354 → 2,381,803

    Phenotypes of a mutant

  • inactivation of ''[gene|B498ED03F19B7A73878D5C947C28C2A87CAB934D|ndk]'' reduces sporulation efficiency to 13.4% that of wild type cells [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • 2'-deoxyribonucleoside 5'-diphosphate + ATP --> 2'-deoxyribonucleoside 5'-triphosphate + ADP (according to UniProt)
  • ribonucleoside 5'-diphosphate + ATP --> ribonucleoside 5'-triphosphate + ADP (according to UniProt)
  • Protein family

  • NDK family (single member, according to UniProt)
  • Modification

  • phosphorylation on Thr-92 AND Ser-123 [Pubmed|17218307]
  • Structure

  • [PDB|1WKJ] (from ''Thermus thermophilus'', 59% identity, 82% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|C45A5935559F0DAAD70F808725AF730BC18A2B0A|hepS]-[gene|DDD40AEBBCBD3C19661A72B85912E266DBF267B3|menH]-[gene|3CAEA54E80A0B56EE120B881C8CDBE055AF6BDC1|hepT]-[gene|B498ED03F19B7A73878D5C947C28C2A87CAB934D|ndk]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|B498ED03F19B7A73878D5C947C28C2A87CAB934D|ndk]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE22730 (Δ[gene|B498ED03F19B7A73878D5C947C28C2A87CAB934D|ndk]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCTCCACCCCATCAT, downstream forward: _UP4_TAATCATTGTGAAAATAAGC
  • BKK22730 (Δ[gene|B498ED03F19B7A73878D5C947C28C2A87CAB934D|ndk]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCTCCACCCCATCAT, downstream forward: _UP4_TAATCATTGTGAAAATAAGC
  • References

  • 17218307,26735940