SubtiBank SubtiBank
ssuA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ssuA

aliphatic sulfonate ABC transporter (binding lipoprotein)
locus
BSU08840
pI
4.85
mw
36.18 kDa
protein length
332 aa Sequence Blast
gene length
999 bp Sequence Blast
function
sulfonate uptake
product
aliphatic sulfonate ABC transporter (binding lipoprotein)
essential
no
synonyms
ygbA,yzeA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.6|Uptake of ions]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW 2.6.4.2|sulfur metabolism/ general]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    962,179 → 963,177

    The protein

    Protein family

  • bacterial solute-binding protein ssuA/tauA family (according to Swiss-Prot)
  • Structure

  • [PDB|2X26] (from E. coli,32% identity ) [pubmed|20383006]
  • [SW|Localization]

  • associated to the membrane (via [protein|91EAC386AD3A373E7CDE0265AA23786ADC55558A|SsuC]) [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|675CE0BCA393E9C2795032F1C0FDE6AF08B77033|ssuB]-[gene|B47C64731FCAA086CA563EEE95D3205428E51EFC|ssuA]-[gene|91EAC386AD3A373E7CDE0265AA23786ADC55558A|ssuC]-[gene|A9F7BEC330EB17CA38C4D421E8BBF58CE380559C|ssuD]-[gene|93F7A5795A423CD8DD7B070F7F37731A5E8D6321|ygaN]
    description
    [Pubmed|11251850]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11251850], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16513748], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • regulation

  • repressed in the presence of cysteine ([protein|search|CymR]) [Pubmed|16513748]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A252 (ygbA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/252 NBRP B. subtilis, Japan]
  • 1A800 ( ''ssuA''::''kan''), [Pubmed|9782504], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A800&Search=1A800 BGSC]
  • BKE08840 (Δ[gene|B47C64731FCAA086CA563EEE95D3205428E51EFC|ssuA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCGCTTCCGCCCTTT, downstream forward: _UP4_CAATGATGAAAGCAGAGGCT
  • BKK08840 (Δ[gene|B47C64731FCAA086CA563EEE95D3205428E51EFC|ssuA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCGCTTCCGCCCTTT, downstream forward: _UP4_CAATGATGAAAGCAGAGGCT
  • References

  • 15937167,10092453,16513748,11251850,9782504,20383006