SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


aliphatic sulfonate ABC transporter (binding lipoprotein)
36.18 kDa
protein length
332 aa Sequence Blast
gene length
999 bp Sequence Blast
sulfonate uptake
aliphatic sulfonate ABC transporter (binding lipoprotein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of ions]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW|sulfur metabolism/ general]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    962,179 → 963,177

    The protein

    Protein family

  • bacterial solute-binding protein ssuA/tauA family (with [protein|56E482D9CAC6E350140FD21A1C4AC8820B918CDA|YtlA], according to UniProt)
  • Structure

  • [PDB|2X26] (from E. coli,32% identity ) [pubmed|20383006]
  • [SW|Localization]

  • associated to the membrane (via [protein|91EAC386AD3A373E7CDE0265AA23786ADC55558A|SsuC]) [Pubmed|10092453]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11251850], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16513748], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • regulation

  • repressed in the presence of cysteine ([protein|search|CymR]) [Pubmed|16513748]
  • view in new tab

    Biological materials


  • MGNA-A252 (ygbA::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A800 ( ''ssuA''::''kan''), [Pubmed|9782504], available at [ BGSC]
  • BKE08840 (Δ[gene|B47C64731FCAA086CA563EEE95D3205428E51EFC|ssuA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCGCTTCCGCCCTTT, downstream forward: _UP4_CAATGATGAAAGCAGAGGCT
  • BKK08840 (Δ[gene|B47C64731FCAA086CA563EEE95D3205428E51EFC|ssuA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCGCTTCCGCCCTTT, downstream forward: _UP4_CAATGATGAAAGCAGAGGCT
  • References

  • 15937167,10092453,16513748,11251850,9782504,20383006